Loading...
12-December-Mocksville EnterpriseVOLUME XXXVI “All The County News For Everybody” MOCKSVILLE, N. C., THURSDAY, DECEMBER 3, 1953 “AU The County News For Everybody” v No. 41 Davie County Has Thirteen ‘Grade A’ Eating Places Sanitation Inspection Shows All Places To Be “Grade B” Or Better Restaurants and eating estab­ lishments in Davie County have posted a good record in sanitation according to the report released by Carl E. Shell District Sanitar­ ian. Mr. Shell reported that all eat- ng establishments in the county were rated “Grade B" or better. He compared this most recent in­ spection with the first one made in January of 1946 when only one place was rated as high as “Grade C.” Mr. Shell stated that “Grade A" represented a score of 90 or above; "Grade B” a score of 80 to 89; and “Grade, C” below 80. “I’m glad to report that we have no “Grade C” eating estab­ lishments in Davie County,” said Mr. Shell. The establishments inspected and the grades as reported by Mr. Shell are as follows: “Buck’s Barbecue, 97; “C’s’’ Barbecue, 96.5; American Cafe, 95; Carolina Lunch, 95; U Stop •N Grill, 95; Village Grill, 94; Hotel Mocksville, 93; Miller’s Bar­ becue, 92.5; Riverside Hotel, 92.5; Hilltop Barbecue, 91; Mocksville , Grill, 90.5; Davie Cafe, 90; The Ark, 90; Johnson’s Pool Room, 86.5; Southern Cafe, 82.5; Sheff­ ield Cafe, 81; Cooleemee Cafe, 80.5. Man Dies In Fire at Home James Badger Cook, 81, a farm­ er and sawmill operator of Yad­kinville, ,Rt. 3, Liberty Church community of Davie County, was burned to death about 6 a.m., Thanksgiving morning in a fire that destroyed his home. Mr. Cook lived in the two room house with a son, Ray. Ray awoke Thursday morning with the house totally on fire. He stated that he did not see his father and made his escape, suffering burns about the face and hands. The remains of the elder Mr. Cook was found' later near the bed. Funeral services were held Sun­ day at the Sandy Springs Baptist Church. Rev. Wade Hutchens and Rev. Paul Moore officiated. Bur­ ial was in the church cemetery. Mr. Cook was married to Mary Joyner, who died several years ago. Mr. Cook is survived by five sons and one daughter: Beatrice and Roy Cook of California; Claude Cook of Blackstone, Va.. Howard, Milford and Alfred Cook of Hamptonville, Va.; and Ray Cook of the home. Five sisters, Mrs. A. J. Renninger of Harmony, Mrs. M. W. Reavis of Mocksville, Mrs. Frank Wooten of Hampton- vllle, Mrs. Clay Campbell of Harmony and fos. Ada Gordon of .Turnersville, IT PAYS TO ADVERTISE NAMED TO HEAD MARCH OF DIMES Vernon Dull, above, of Mocks ville has been appointed chairman of the 1954 March of Dimes for Davie County. The announcement was made by D. J. Mando, chair­ man of the local chapter of the National Foundation for Infantile Paralysis. , Mr. Dull is a graduate of High Point College and as the present is associated-with the Davie Fur­ niture Company of Mocksville. He is executive vice president of the Mocksville Junior Chamber of Commerce and a member of the Wesley Chapel Methodist church. The March of DimS, conducted nationally each January, is the sole support of the National Foun­ dation and its 2,000 local county chapters^ Funds contributed to the annual drive pay costs of medi­ cal care and treatment for polio victims and finances the scientific research and professional educa­ tion sponsored by the National Foundation. The 1954 campaign will be held Jan. 2 through Jan. 31. Rotary- Holds Farmers’ Night Approximately 7 6 Rotarians and guests enjoyed the annual “Farmer’s Night” banquet of the Mocksville Rotary Club Tues­ day evening. Following a turkey dinner, the group was entertained by “a one man band, masqueradiing under the name of ‘Panhandle Pete’ With an outfit ■' that featured drums, all types of horns, etc., this, man played a guitar and a harmonica along with tho drum and horn outfit to furnish music to the group. Hailing from. Ashe­ ville he is scheduled to appear on the Arthur Godfrey television program on Dec. 9. President Graham Madison pre­ sided over the program. J. C. Jones made the address of wel­ come. Leo Williams introduced “Panhandle Pete.” Hugh Larew served as pianist. Use An Enterprise Want Ad Local National Guard Unit Receives ‘Superior’ Rating “Best Medical Unit Ever Inspected,” Says 3rd Army Inspector The local unit of the North Car­ olina National Guard, Medical Company, 120th Infantry, receiv­ ed a rating of “Superior" at the annual Third Army inspection on Nov. 24. Colonel Rotrick of tho Third Army Headquarters, Fort McPherson, Ga., was the inspect­ ing officer and reported that this was “the best medical company he had ever inspected. The following ratings were re­ ceived by the local unit: Administration, Superior. Supply, Superior. Maintenance, Superior. Charlie McClamrock In Serious Condition Following Accident Charlie McClamrock is in ser­ ious condition at. the Davis Hos­ pital in Statesville as the result of injuries received in a wreck eariy Sunday morning. Mr. McClamrock is believed to have turned his car over on his way home from work at the Vet­ erans Grease and Tallow Company soon after midnight Saturday. He was found around 5:30 a.m. Sun­ day morning by Cedric Smoot of* Mocksville, Rt. 2, as Mr. Smoot was making, early morning deliv­ eries of newspapers. The accident occured on the curve near Ijames Cro^s Roads Church; Mr. McClamrock was taken to the Davis Hospital where early reports placed him on the critical list. His leg was reported broken in seven places, a back injury and multiple bruises and abrasions. He also suffered from exposure. Mocksville Guidance Program Is Outlined The aim of the guidance pro­ gram in the Mocksville School is to enable each pupil to understand his abilities . and interests and to develop them as well as poss­ ible. To reach this goal, guidance is started in the first grade. During the first year the pupils’ cumu­ lative record is started. The other teachers continue ■ to collect in­ formation as long as he is in school. An important source of data !for the cumulative records is the. achievement tests given in the -fourth and seventh grades. This year an aptitude test was given in the i 1th grade., In addition to the guidance carried on in the homeroom, each teacher devotes much time to guidance in the classes. In the 11th grade English classes a unit on vocations is being studied. The pupils have been given an oppor­ tunity to discuss the importance of the choice of a vocation; to / ' make a general survey of the vo­ cational world; and to report on specific vocations in which they are interested. , During the last two years in high school, more lime is devoted to vocational guidance. Each pu­ pil is given an opportunity to have a conference wth homeroom teachers. Problems concerning school work or personal adjust­ ment, as well as his plans for the future, are often solved. Mater, ials on the various occupations and professions, and information on colleges, schools of nursing, and trade schools are available to all students. A follow up study of all grad­ uates is made and a record of this information is kept on file. In addition to a study of gradu­ ates, a study of drop-outs is. con­ ducted to determine the cause of pupils leaving school. East stu­ dent is encouraged to remain in school. Civil Court To Convene Here Monday The December term of Civil Court will convene Monday morn­ ing with Hon. Dan K. Moore of Sylva as >'he presiding jurist. The trial docket as released by S. H. Chaffin, Clerk of the Su­ perior Court, shows the follow­ ing cases: Monday J. J. Allen vs Rober Sinith and Grady owden; A. D. Pharr vs Paul Hodges; Lucy Cuthrell et al 'vs Susie Whorton and hus­ band, Monroe Whorton, et al; Pearl L. Kanaverskis vs Anthony A. Kanaverskis; Barnett Film Service vs Milton Parker t/a Par­ ker Cabs; John J. Ward vs Clara Lipscomb Harris; F. M. Robertson vs Benjamin F. McKenzie and Susanne G. .McKenzie; James Fleming vs, D & M Coal and Fuel Company; R. E. Bean vs George Washington Hill; Modern Sewing Machine Company 'vs E. L. McClamrock; Mary Nell Hol­ man vs Guy Holman, Clyde El­ bert Holman and Claude Hicks, trustee; Treva Mae Cranfill vs Hubert H. Cranfill; Roberst L. Fritts vs Pearlene Y. Fritts; Ina Mae Howewll ,vs Manuel (Til) Howell; Bobby D. Wall vs Doris W. Wall. • Tuesday Helen M. Sher. vs .Cloverdell Farms, Inc.; Earl R. Beauchamp vs E. T. Robertson and Jack Fred- rick- Blair, Jr. and Jacw Freder ick Blair, Sr. (Additonad defen­ dants); Daniel- Furniture and Electric Co., vs Henry M. Shoaf; L. R. Powell, R. P. Powell and B. F. Powell t/a L. R. Powell’ Co. vs Sandhill Furniture Corpora­ tion; Roy Beauchamp, Jr., vs Will­ iams Thomas Minton; J. J. Hoots vs Atlas Smoot and, G. E. Black­ welder t/a Mocksville Implement Company; Ralph Wright et al vs Steve Boris; James Shoffner vs Sid Steelman;' James R. Ryan vs J. C. Ijames. Wednesday Shirley Ann Presnell by her next friend, Edward Presnell, vs Sidney J. Shore; Edwarrd Pres­ nell vs Sidney J. Sohre; Charles S. Hellard et ux vs E. M. Dead- mon et al; Sarah Louise Haire vs J. E. Durham, Agent, et al; H. F. Blackv/elwder vs H. C. Cline and Atlas Supply Company, A North Carolina Corporation; L. J. Lu- per„ Admr. W. R. Carter, de­ ceased, vs Bank of Davie, in the matter of Ellen Carter widow of W. R. Carter, deceased. CIRCLE iVJEETINGS Circle 1 of the Woman’s So­ ciety of Christian Service of the First Methodist Church will meet Tuesday, Dec. 8, at, 7:30 p.m. at the home of Mrs. B. I. Smith, Sr., on Salisbury St. Circle 2 will meet at the home of Mrs. P. J. John­ son on Maple Ave. on Tuesday, Dec. 8, at 7:30 p.m. ~ Davie CROP Drive Reaches $844 Total A total of $844.39 has been col­ lected thus far in the Davie Coun­ ty CROP Drive, chairman Paul Richards announced this week. The goal for iJavie County is $1,- 000. Mr. Richards in making ihis announcement stated that the re­ sults thus far. were very gratify” jnc. • ■ "We have passed the receipt total for, last year by about $50 and several sections of the coun­ ty have not yet reported,” said Mr. Richards. ’ He requested that all those who have not reported to do so to the county agent’s pffice, this week if possible.__ __•____; , . A Note to Santa Claus Dear Santa: As you make up your pack for for annual visit this Christmas please don’t overlook William Luther Cline on Mocksville, Rt. 3. William Luther Cline has1-had his share of trouble. He was a cripple at birth, and had an attack of polio when he was but six weeks old. Now at the age of 35, he has never been out of bed a whole day at a time in his life. He requires constant attention. Jle lives with his mother, step­ father Mr. and Mrs. John An­ ders and sister on the W. R. Pat­ terson farm. They are very poor people. This Fall, the three have -travelled• ■all 'over - Iredell 'and Davie counties picking cotton for people. On these trips and while they were working, William Lu ther Cline sat in the old car at the edge of the field—always un­ complainingly. At the present time Mr. Patterson is allowing them to cut some pulp wood from his farm to sell in order to derive a livelihood. Mr. Anders and the girl, 28 years of age, cut and pre pare , this pulp wood for market. The girl, Daisy Cline, has ac­ quired a collection of Indian ar­ rowheads, from which she sells now and then in order to buy food and clothing for the family. Santa, until recently this man had an old radio to which to listen. Being unable to attend church, he enjoyed the services on Sunday morning as well as other programs throughout the long days. But now this radio is broken. Neither he nor his family have ever.,received much, nor expected much at Christmas. However, this year this man would appre ciate an old battery radio so that he could hear the Sunday services and other programs. The house in which they live is not wired for electricity, so the radio must be of a battery type. When you make up your pack for Christmas please keep the re­ quest of William Luther Cline in mind. You may write him in cars of Mrs. John Anders, Mocksville, Davie Thief Captured In Winston-Salem Monday James Nichols Is Honored For Work As Local Scoutmaster Training, Superior, Appearance of personnel in uni form, Superior. The inspection was conducted in two phases. The afternoon phase consisted of the inspection of all unit administration, supply, vehicle maintenance and kitchen equipment. The evening phase! consisted of an inspection in ranks of all personnel, following which unit training was observed. The present strength of the_ company is six officers and 62 enlisted men. Captain Hugh Andrew Lagle is the Company Commander. Ma­ jor Charles H. Wiggins of tho VA Hospital in Salisbury, is the Pegimental Surgeon. James Nichols above, was hon­ ored for his work as Scoutmaster of Troop 575 of Mocksville at the annual mee.'ing of the Uwharrie Council in High Point, ‘Tuesday night. Mr. Nichols was one of five scoutmasters in the council to re­ ceive the “Scoutmaster’s Recog­ nition Award.” This award is based on the ad­ vancement of boys in scouting; registration of new scouts; “Boy’s Life” membership; and attend­ ance of meetings. The award was presented by Clyde Hunt, vice-president of the executive, board of the Uwharrie Council. Curtis Price o f ' Mocksville, Council Leadership Training Chairman, presented the Scout­ master’s key award. The annual council meeting which wap held in High Point was attended by many from Davie County. JAYCEES HONOR FOOTBALL TEAM Members of the Mocksville High School football team will be hon­ ored Thursday evenng at a ban­ quet. given by the Mocksville Junior Chamber of Commerce. Highlight of the evening will be the presentation of the “most valuable playerV'award to the in­ dividual deemed the most valuable to his team during the past sea­ son. The name of the boy will not be revealed prior to the presen­ tation. This will be the fourth of these anual banquets. Past recipients of the award have been: Turner “Skeeter” Ammons, 1950; .Frank McDaniel, 1951; Johnny Hodgson, 1952. • Prisoners Flee From%Local Camp Two Negro prisoners fled from a road gang working out of the Davie County Prison Camp Mon­ day afternoon. They were identi­ fied as Earl Junior Maye, 32, of Charlotte, serving 7-10 years for armed robbery and two years for auto theft during a previous es­ cape; and Alton Dowd, 23, of Southern Pines, serving 3-5 years for breaking, enterin gand larceny. Johnny Bailey, 21, Charged With Series Of Thefts In County The man sought for the past two weeks by Davie County offi­ cers and the State Bureau of In- estigation as being responsible for certain break-ins, in and around Davie County, was arrested Mon­ day night in Winston-Salem. Sheriff G. Alex Tucker iden­ tified the man as Johnny Bailey, 21, of Mocksville, R6ute 3, who returned to this county sometime ago after a stay in Michigan. Bailey is being held . at the local jail pending completion of charges to be lodged against'him. ■Local officers, assisted by SBI agents J. P. Thomas of Statesville and R. H. Garland of Wilkesboro, have been investigating some 40 breaking and entering cases in Davie County since January and have recovered a large amount of the loot. Recoveries have been made in Davie, Randolph, and other counties as far west as Cherokee. Two Winston-Salem men have been charged with the receiving' and selling of stolen goods. These men, who are free under bond,, were: identified at R. L. Reavis, 59,' and George Perry, 57, both of Winston-Salem. Officers tied Bailey in with the thefts several weeks ago. How­ ever, the man fled from the home of his father and managed to evade capture until Monday night. VFW Meeting Friday Night The regular bi-monthly meet­ ing of the Veterans of Foreign Wars will Be held Friday, Dec. 4, at 8 o’clock. Special out-of- town guests will be present. Com­ mander Clay Allen urges all members to be presertL . The local VFW Post was the first post in the state to report on Community Service. Farm Income Is Down 5% The Agriculture Department reported last week that farmers received about $23,300,000,000 from marketing the first' ten months of this year, five per cent less than the same period last year. It said lower prices were only partly offset by increased volume of marketings. As of mid-October latest figures available, the aver­ age of all prices received by farm­ ers was down 11 per cent from last year. The -report from the Agricultur­ al Marketing Service said farmr- ers cash receipts from livestock and livestock products from Jan­ uary through October were down seven per cent from last year. Crop receipts were down two per cent. from a year earlier in the 10-month period. For the month of October alone, the report said, farmers’ cash re­ ceipts, were down six per cent from a year earlier. IT PAYS TO ADVERTISE Welfare Department Ready To Help Spread Yule Cheer THE MEDICAL UNIT OF THE N.'C. NATIONAL GUARD RATES HIGH on recent Third Army inspection. Top left photo, First Sergeant Baxter Deadmon reports: “Sir, all present,” to Cap­ tain Hugh Andrew Lagle, Company Commander, as company is formed for Third Army Inspec­tion. Lower photo, at left shows several members of the company discussing the results of the inspection. They are Cpl. Charlie Johnson, cook; Cpl. Harold Rollins, ambulance driver: Pfc. Cal­ vin Prevette, squad leader; and Pfc. Harold Murray, aidman. Photo at right shows kitchen equip­ ment displayed for inspection as Sfc. Grady Flowers, stands by. . (Enterprise Photo), “The department of public wel­ fare will be glad to cooperate witli any group or organization wishing to make gifts to peopli? in need of Christmas cheer in this county,” according to Miss Amy Talbert, superintendent of public welfare. There is value in having a clearing house which is available to help organizations select with1 care the people who are to receive the Christr.ias gifts of the group, the superintendent pointed out, since . all organizations wish to avoid duplication and the possi­ bility of leaving a needy person out. ‘‘This* department will gladly channel gifts of m oney or articles of food and clothing in accordance with the wishc-s of the individual or group which makes the gifts. We suggest that whoever is re­ sponsible for Christmas projects get in touch with our department early if he wishes our coopera- ation. We can render better ser­ vice if we have sufficient time to work in accordance with the wishes of the organization,” the superintendent said. PAGE TWO THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 3,1953 The Mocksville Enterprise Published Every Thursday at Mocksville, North Carolina MR. AND MRS. EUGENE S. BOWMAN...............................Publishers GORDON TOMLINSON ...........................................................I........Editor Entered at the Post Office at Mocksville, N. C., as Secona Class Matter Undei Act of Congress of March 8, J879 The overwhelming vote in favor of the proposed hos­ pital project for Davie County was very inspiring to those who recognize the need for this service institution. A total of 1532 votes were cast in favor of the bond proposal Only 74 votes were cast against it. This represents a majority of 20 to 1 and thus represents the sentiment of. the county. The vote surprised most everyone. Many felt that there was more opposition to the proposal than was registered by the vote. However, the vote was for the purpose of determ- ing the sentiment of the citizens of the county, and this is what it did. , -......Some, may point to-a-light-vote-by comparing it with. elections in which candidates’are seeking office. Ths is not a fair comparison. Some point out that there was probably more opposition than 74 votes, but that this opposition stayed home and did not vote. This also may be true, but the fact remains also that there are consider­ ably more than 1532 people in the county desirious of a hospital, some of these also stayed at home. This newspaper feels that the ratio of 20 to 1 is a pretty good indication of the desires of the people in this matter. It is doubtful that an increase in the vote would change this ratio. The people have spokfen. The next move is the ap­ pointment of a board of trustees by the county commiss­ ioners so that the actual machinery of turning the hospital into a reality may be set into operation just as soon as possible. Hymn Is Burn ^ 2 ^ 5 ^ 2 0 BY CLINT J BONNER JT* ^ j r t T h e r e I s A F o u n t a i n F i l l e d W i t h B l o o d A t r o u b le d p o e t p r a y s f o r h is s o u l Willinm Cowper suffered all of his 69 years. Due to a weak constitution, ho suffered physi­ cally. Due to uncontrollable melancholia, he suffered mentally. Ho believed that God had doomed his soul beyond redemption. This be­ lief drove him to attempts at suicide and he was committed lo insane asylums four times. He had studied law but could not plead cases because o£ stage fright, and his speech was im­ paired by lisping and stammering. Yet, when he had control of his faculties, William Cowper produced poetry that placed him among the foremost of England’s literary giants. Tho world can thank, among', others,, the Reverend John Newton . . . the one-time sailor and slave trader.. . . for bringing out the best in Cowper. While Curate at the town o£ Olney, Newton gave the poet a home and put him to There is a fountain filled with blood, Drawn from Immanuel's veins, And sinners plunged beneath that flood Lose all their guilty stains. The dying thief rejoiced to see . That fountain in his day; . > And there may I, tho' vile as he, Wash all my sins away. work. Ho built him a house in a garden back ol his rcsidcnco where tho strange little man played with rabbits nnd talked with birds. He encouraged and collaborated with him In writ­ ing hymns for weekly prayer meetings. Thus came into being tho famous collection of “ Olney Hymns” . . . among which is found some of the finest work in English literature. During the early part of the last century Composer Lowell Mason . . . who spent his youth as a bank clerk in Savannah . . . cast about for poems to set to music for his Boston, choirs. Among his selection was William Cow- per’s “There is a Fountain Filled With Blood.” The little poet had died, still praying for his soul in 1800. But he had written hymns that were to carry his name through the ages . . . among them being—. E'er since by faith I saw the stream Thy flowing wounds supply, Redeeming love, has been my theme And shall be till I die. Then in a nobler, sweeter song I'll sing Thy pow'r to save, When this poor, lisping, stammering tongue Lies silsnt in the grave. A Sign of Christmas Once again Christmas has sneaked up on us and now is just around the corner. To the 'children of this community, the coming of Christmas is perhaps the best news of the year, and among adults it is rare to find one who does not recall, with some emotion and' memories, happy Christmases of earlier years. One of the more important events of the Christmas season is the annual Christmas Seal sales. It is particu­ larly appropriate that the sale of these seals, the proceeds from which go into the fight against tuberculosis, comes at Christmas time, because tuberculosis kills more young people than any other disease. This year’s Christmas seal portrays the spirit of chil­ dren at Christmas time, and reminds us that the buying of Christmas Seals helps in the fight against tuberculosis. The Tuberculosis Association in this county is again at work this year in behalf of this community’s children. Every Christmas most of us are given the opportunity to support this association by buying Christmas Seals. The sale of these seals is the only source of funds for this work, and it is an honor to be asked to contribute to the Christmas Seal campaign. Citizens in the county have always responded gener­ ously to this drive and this newspaper urges them to do so again this holiday season. From The Book, -A HYMN IS BORN” Copyright 1952 — WILCOX-FOLLETT CO., Chicago, Illinois. m W W ^ W V .W . V . V V A W .W . ’ . W . V . V . '. V W W V W , | W ashington N otes S V .V A - A V W .* . W .V .V .W . W .W . W . V . V . V . V . V W W . ’ A Hopes for peace with Russia, | of Russia. I which soared just after the death Today Russian tank, plane and j of Joseph Stalin, have sagged artillery strength are still secret j badly in Washington in the last but tre Reds possess a huge edge j Ike and “McCarthyism” Tiie New York Times Washington Bureau recently polled some 80 newsmen in the National Capital to see if it could ge the answer to former President Harry S. Tru­ man’s charge that the new Administration had embraced “McCarthyism.” Mr. Truman claimed that it was now evident'that the Eisenhower .Administration had embraced the political tactics of Senator Joe McCarhy of Wisconsin. When the New York Times Washington Bureau polled •the men and women who attended the President’s weekly news conference, it was found that a majority thought the President innocent of this charge. However, the newsmen were of a different opinion concerning this Administration. The newsmen were of the opinion that there were cer­ tainly two wings in the Republican Party, and that the President was in a different one from that of the Senator from Wisconsin. This fact was clearly bome out as the result of McCarthy’s nationally televised address last week. The majority of the reporters did believe that some officials, like Attorney General Herbert Brownell, Jr., or the Administration itself had resorted to wjiat is commonly termed “McCarthyism." Thus the reporters gave a vote of confidence to the President, although they would not do so for the entire Administration or his party, This is a tribute to the popularity of the President and to the working press’s opinion of his Integrity. four weeks. (The Russians wanted the Korean fighting stopped in March, April and May. They were somewhat hesitant to risk a War with the United States that time. Uncle Sam had the hydrogen bomb and the Communist didn’t It was like 1946 all over again— when the United States had the atomic bomb and the Russians had not yet developed the wea­ pon. Like 1946 the bomb was the major stop sign holding back Com­ munist aggression against the free world. Now Kremlin leaders know they have the hydrogen bomb secret too. There are reports, not confirmed, that the Russians have discovered a cheap and easy way to make the hydrogen bomb. U. S. scientists know that is quite possible, technically, although they doubt the reports for several reasons. But it is possible. The Reds solved the hydrogen bomb puzzle after the Korean fighting ended, and Premier Geor- gi Malenkov waved the olive branch for two months after as­ suming power. Malenkov at that time announced that his pro­ gram would be one of more and cheaper goods for the people, and he aimed the economy in that di­ rection. There are signs in the puppet countries this program is official policy. But the Red Army is re­ portedly insisting the armed ser­ vices get more attention. Malen­ kov, not a military man, is suc­ cessfully mantaining his hold on the throttle, bith with civilian secret police chief Beria out, and a new man in his place, the Army leaders carry more weight. over the United States Now that| they tfiink they are close at U. S.; heels in the field of atomic ener-| gy, they become dangerous, bold­ er and could become very much more aggresive. The latest Kremlin note to Washington reflects just such a trend. Moscow was more blunt 60 Second Sermons By FRED DODGE sou VACANCIES . . . Unless Governor William B. Umstead is a mighty patient man — and a fellow of considerable undorstand- ■ ing—he is no doubt sharply miff­ ed at the way some of his asso- date? hero arc apparently stud- I iously desrei’ arding his nods of | arroroval for vnrous ind’vidunU j looking for employment \vi‘h the 1 State. It happpnea acmn lart wei»k. A meniiber of his campaign headouartors staff and a loyal worker in the Democratic organi­ sation Inst fall and in the recon’t bond n'unpajcn had been looking for a job in one of the State offic­ es here. She had endorsements from Democratic leadership, in­ cluding the Governor’s personal endorsement. Day followed day — but no po-. pition. Well, perhaps there were no vacancies. A little informal investigating might be In order— just for curiosity. What do you think? It was dis­ covered that, as of last week, there were OVER 500 VACANCIES IN ST/fTE JOBS; and this did not include S*ate institutions and co1 leges. Other people were em­ ployed, but not the loyal party worker. It is understood that a list of the various vacancies has, been provided the Governor and he has been advised as to those de­ partment and divison heads who have bypassed his recommenda­ tions. Details have been furnish­ ed as to ins'ances, including a comparison of the qualifications of the persons suggested by the Governor and the person employ­ ed I WHY? . . . Did you know that North Carolina has the lowest i percentage of high school gradu- | ates entering college of any state in the Nation, i Why should this be? Text: “Where all think alike, | This is one of the things Great- than in months, pbssibly years.1 none think very much.”—Walter er University President Gordon- The administration from the Pres-1 Lippman. Gray wants Governor Umstead’s ! Higher Education Commission toident down, noted' the icy tone J with dismay. And peace pros­ pects, which many thought bright­ er when Joe Stalin died, suddenly disappeared around the corner. An artist who wanted a home look into, in the hills of Vermont was talk-j What is your opinion? ing it over with a farmer who ------------- allowed that he had a good house ( EXCESS FAT . . . The Higher for sale. ^ | Educaton Commission named to I must have a good view,’’.said study State operated colleges, uni-Conflicting estimates on next year's business activity continue j the artist. “Is there a good view?” -Versities and units of some, is ex- to come into Washngton, and out “Wal," said the farmer, “from peeled to come up with some of 'Washington. In recent days; the front porch yuh kin see Ed rather startling facts and figures, there have been several bright Snows barn, but beyond that' ^s to how much “fat” we have predictions from the business there ain t nothin but a bunch o f, accumulated, nobody knows. But world to back up official Wash- mountains.” ington pronouncements that there ------------- will be no serious drop in the na- ^ Mark Twain tells us that it tion’s economic health. Some of the more recent pre- makes horse races. Were it not for WCUNC Prexy Ed Graham has unconsciensly revealed that in ... . . , this day of the plentiful dollaris a difference of opinion that , . . , . .,,r . maybe we have become used to The next purge or in-fighting in Russia may be between the Army and Malenkov. Either Ma­ lenkov is getting bolder as a re­ sult of Russan H-bomb progress or he is being prodded by the army. Whatever the motivation is, Washington knows that rela­ tions have suddenly worsened. ' And despite the U. S. rearma­ ment rogram, which has the na­ tion at least partially prepared, the Reds still have a great pre­ ponderance of military, equpment especially artillery, tanks and fighter planes. It will be recalled a lot of fat. He says the Higher Education Commission should ir>ok into “excess fat,” meaning dictions estimate consumer spend- differences of opinion about all ing will be up next year over things, this would be a dull world. 1953 totals. And 1953 has been a If only one style of house were at- record year for most businesses, tractive to everyone, there would a accumu a e y e eowned colleges. Tn other words, a little fat is all ricjht—but the avnirdupious should not be permited to run to exrpssive proportions. “All of us have some exeecs but since taxes will be lower and be no progress in house-building, average wages higher, it’s likely The farmer may see only the that consumer spending will also utility of the barn as a thing of be higher next year. beauty. The artist finds-beauty in the hills.The question is whether reduc- , , ..... — .....- -------- --------- ed government spending will off- f most deadly block- f[)t We know lt But we are not set this change, more than offset f es °. Pr°6ress is o ernan la trninff to get rid of it ourselves. it, or prove a better influence on * °Plnlons °f others must con- We 0Ught to be trained down to the national economy than the form to ours, or be worthless We fighting trim,” said Graham. higher wages and lower taxes.' I™?1 euard against an attitude) “it may just be 1hat the High- One clue might be found in the . admit an opinion ^ Education Commission will not attitude of many of the country’s that ^differs with ours. We could 1T1orR]y recommend the trimming big companies. Spokesman for wrong. | Qf excess fat, but all the lard Sears, Roebuck, many of the ' which has been attaching Itself biggest insurance companes, c£mce that applies to every human to state institutions within the Macy’s and others have all said. t>e*ne> __ ____ | past couple of decades. recently that another good them. 1954 looked like business year to The Meaning: of “Follow Me” The fact that Jesus Christ gave1 HERE FIRST . . . Ten days be- a uniyersay invitation to follow f0re Drew Pearson charged in one Him is attested in multiplied ways, 0f his broadcasts that Charlotte and instances in the New Testa-! had corruption in its police de­ ment. There can be no doubt but partment, you read here that he that He regarded Himself as the [ was preparing just such a state. Messiah of God, the “One who ment. should come’ in fulfillment of the; w e got it straight—from one of prophecies and the jexpectations' those “unimpeachable” sources. not “Follow Me” have come to have ic utterances. And as one of the documented his charges. Char- vast significance in the world. We proofs and climaxes of His own lottle folks were lighter on Pear- note from Ihe New Testament that assurance of His divince origin SOn that were Presidents Roose- the words were frequently on and office, He asserted, “I am the V'elt and Truman. After an offic- the lips of Christ as He went way, the truth and the lifeiuno jai inves'igation ,a member of about the task of reconstituting man cometh unto the Father but the Charlotte City Council last the Church and of setting forth; by me," John 14:6: Therefore, the week called the Washington com- merely a “common boys—Roy and Mayon o£ Ahos- l:ie, and Lee of Raleigh—Chowan College would now be where Davenport, Rutherford, and a number of other fine little schools are: sleeping, sleeping — gone and all but forgotten. That’s why we were deeply pleased last week to • learn ■ that trustees of Chowan have named the graphic arts^ department' of ' the 105-year-old institution' the - Roy Parker School of Printing. When I took over this column nearly a year ago now, one o f ' the people I asked for advice and' assistance was my old friend,, Roy- • Parker. He has given it.' I am told by friends here that' five years ago when a good Bap-" tist brother would chance to men­ tion Wake Forest, Meredith', Mars ■ Hall, or Campbell to Lee, Mayon, or Roy Parker, they would im­ mediately come back with: “What1 about Chowan? What are we go­ ing tci do about little Chowan?” Plenty is now being done about ' it — thanks to the Parker broth­ ers, owners of newspapers, good ones, too, in the counties of Here­ ford, Gates Northhampton and' Bertie. They and some other old' frends of education were determ- ‘ ined that Chowan should not fade • away. No college ever had more devoted servants than these and' iron-jawed President F. Oi Mix­ on and his associate, the Rev.'. Oscar Creech, a saint, dear read­ er, if ever there was one; Wake Forest is much closer to' Winston - Salem than most o f you realize. And when it is gone, there will be only two undergrad­ uate Baptist schools east of the" Piedmont to which boys can go' for their education: Chowan in' the northeastern counties and’ Campbell for the southeastern. Now as for old Roy Parker, a ’ book could be written about h int. He, like Chowan, was in such bad’ health six or eight years ago— and many times since-----that" friends despaired of his recovery. . But now, thanks to each other- probably! .Chowan College and Roy Parker are in the pink o r condition—or so it seems from’ here. ‘Follow Me’ (Luke 5:27) By REV. G. C. GRAHAM Farmington Methodist Church These words of Jesus Christ, of all who believed the prophet-j As yet, Brother Drew has that Nazi Panzer General Heinz Guderain estimated Red tank’ the new forms that the Kingdom first and most important meaning mon tater strength in 1933 at 10,000—an es-' timatc which caused ridicule at that time. But when Hitler believed the rosier figures of other surbordin- ates in 1941 and attacked Russie (with 3,100 tanks), he found to his dismay the Russian tanks not only outnumbered him, but the T-34 was better than anything the Germans had. Hitler told Gu­ derain months later he probably would not have started the war of God sould have following His °f the text is that Christ is a liar." The Presidents dipped fur- work and revelation. i Guide to follow, He is the “Way” , ther into the alphabet. In the instance of the text, the, by which we find God. | Now the Pearson revelations words were addressed to Mat-1 A second function that the text have been referred to a grand thew the tax gatherer. And the' implies is found in the term that jury. There is even some hint record says that Matthew “left Christ employed of Himself when that Drew Pearson himself may all, and followed Him.” This we He said, “I am the Good Shep- take to mean a literal act, which. herd" (John 10). Here the mean- eventuated in the apostleship of, ing is plain that He regards Him- Matthew as one of the twelve se>f the leader of men, and that Apostles who became full-time followers of Christ. However, the words “follow me” as used by had he known the true strength j Christ have a universay signifi- they are to follow His leadership. be summoned to appear statement—or statements. for a DESERVED HONOR . . . We have always had a sneaking sus- The designation of human beings picion (don’t ask me why suspic- as “sheep" was famliar in Old ions are always "sneakng") that (Couttnuetf on Page •) I had it not been for the Parker CHOICE . .. There are no better' loved church papers in the South’ than the Biblical Recorder, week-- ly journal of the State Baptist' Convention, and Charity and' Children, Baptist paper printed' by the orphans of .Thomasville' Orphanage. The Charity and Children, the' Sunday School paper used-as a shield for nodders in church for many a year now, has its full' quota of fine editors. Until only a few years ago the Biblical Re­ corder was privately owned. It is now the property of the Bap­ tists. Both are great publications—■ bolh are weeklies. But evidently the Baptists don’t think they can- afford to keep both of them go­ ing, for as we understand it a committee has been appointed to1 see which has the greater merit or which paper they can least afford to give up; ----- z— —... Well, I personally doubt that the Bibllical Recorder will be dropped. But the Charity and Children has something about it which somehow, the Recorder— to our way of thinking—has never been quite able to reach. The Re­ corder may have more dignity; but Charity and Children just seems to have more personality. It may be that the Baptists will decide they must continue both publications.. We hope so. IT’S IN THE BOOK I have heard that it is unlaw­ ful to park a car and fail to pull up the hand brake. Is this true? —F. Y„ Monroe. Yes, Motor Vehicle Manual reg­ ulations, in describing the cor­ rect procedure for parking a mo­ tor vehicle, says you must first stop the engine and then “effect­ ively" sot the brakes. Under the same regulation the law says you must turn the front wheels to­ ward the curb when parking on a grade. M.Y.F, MEETING The sub-district M, Y. F, will meet at Cornatzer Methodist Church, Thursday, Recember 3, at 7:30. THURSDAY, DECEMBER 3, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE PAGE THREE Macedonia The Communion will be ad­ ministered al Macedonia Morav­ ian Church Sunday, Dec. 6 at the 11 o’clock scrvice. Union scrvice with the Dulins Methodist Charge, Macedonia Mo­ ravian and Yadkin Valley Bap­ tist Churches will be held at the Valley Baptist Church Sunday night, Dec. (J, at 7:30. The Women of Macedonia Mo­ ravian Church will meet with Church Sunday morning, Nov. 22. Mrs. Rosa Riddle Thursday night; After the Wednesday night Thanksgiving guests at the tion of those interested in “parra- home of Mr. and Mrs. Joe Howard kects.” were: Mr. and Mrs. Allen Howard j Mr. and Mrs. Bill Leo had as and family, Mrs. Leo Allen and • their iThanksgiving guests at the children, Mr. and Mrs. Greene turkey dinner, Mrs. Lillian Smith, Bnrnes and family, and Mr. Bru-j Mr. and Mrs. E. D. Crews of Win­ ner. | ston-Salem and the Rev, Mr. Bru- Mrs. Viola Styers who has been ( ner. a guest in the Frank Sheeks homo | Mr. and Mrs. George Smith of for the past week, has returned Homestead, Fla., attended the fun- to Mr. Harper’s home, across tho,eral services of Mrs. Mablo river, on the Lewisville Road. Misses Elizabeth and Dorothy Eisenhardt of BetHlehem, Pa., attended Macedonia Moravian FHS Echos By SHERRILL BRINKLEY & EMMA SUE ALLEN Revenge! sweet revenge! the great praise to Rachel Langston, Lillian Pilcher and Bessie Seats for their great work in holding down the East Bend forwards. The boys game gave the fans their money’s worth. Like the game at East Bend it was tied Seats Theatei' ball players seemed to say, as | several times. The Cloudbusters j Division they walked off the court Tues- had a ° ne point margin with 30 day night after winning the twolseconds to go. Johnny Boger and Pvt. Charles Barker Serving In Korea Pvt. Charles L. Barker, whose wife, Elsie, lives on Route 3, | YADKINVILLE, N. C. Advance, recently arrived in Ko- fi7ursday & Fri(1ay| I)ec. 3 & 4 rea for duty fith tho 25th Infantry SPLIT SECOND” Rushed to Korea during the ’ s^ rr,i"S Stephen McNally, Alexis , , j , ... f Smith anil Jan Slcrling. Also_ . ,, . . . . , I sarly days of the conflict, thereturn games from East Bend.; Francis Ellis; added 2 points each | 25lh InfaiUl.y took pan in someTM, _ ..1 ~ — xl_ri _____1 in fnncrv lnef ennnn/ie tn ruit Imo v A at 7:30, Dec. 10, for their month­ ly meeting. Mrs. Ernest Riddle will be joint hostess. Mr. and Mrs. Frank Sheeks called on Mr. and Mrs. Chal Walker, ,Bixby, Thursday night. Mrs. Walker is confined to her bed mostly. The Advance Fire truck was called to a burning auto on thej ing. Yadkinville highway beyond Far- Lawrence Lee Mock, son of Mr. mington, Saturday night at 11 and Mrs. George Mock, Advance, o’clock. The burning car was near j Route 1, and Miss Nancy Jane a dwelling and it was feared the! Nelson, daughter of Mr. and Mrs. explosion would set the home W. C. Nelson of Winston-Salem prayer service at Bethlehem M, E. Church, conducted by Herbert Smith at Bethlehem M. E. Church The girls taking the first game in these last seconds to put the Thanksgiving day Mrs. Julia Howard is visiting her daughter, Mrs. Rob King, and family. The Revs. Cheshire and Bruner were Sunday evening supper guests of Mrs. Ellen King and on fire. The Rev. and Mrs. G. E. Smith and Rev, Bruner enjoyed Thanks­ giving diner at the Smith Grove School, Wednesday noon before Smith, the men from the tw o' family. churches divided the fruit, vege-| Mr. and Mrs. Joe Harding King tables and canned goods and the,are the parents of a baby boy, gifts of money, among 11 families born last week in a Winston-Sa- where there is sickness, old agej 'ern hospital, and a need of encouragement, andl and Mrs. Howell Mackey distributed them the next m o r n -'spent the week end with Mrs. Mackey’s mother, Mrs. Pansy Smith at the Advance Cross Roads. Pfc. Mackey took his training at Ft. Benning, Ga. ,and in a few weeks he will leave for a camp in California. Mr. and Mrs. Wilbur Todd ofwere united in marriage Thanks- 35 to 31 and the boys the second, | Cloudbusters ahead to stay. These 45 to 400. As you can see, both boys also led the scoring through- galnes were, real thrillers." out the game with 17 and 19 points respectively. Coach Stan­ field was very pleased with theThe girls battled on even terms throughout most of the game with the Cloudbusters dominat­ ing the scoring'by one and two action of his boys but he is plac­ ing more emphasis on foul shots, in the first three quarters. Emma They seemed to cause him and the Sue Allen led the scoring attack with 23 points. Coach Dull gave giving holidays visiting their par­ ents at Yadkinville and Mr. and Mrs. John Sparks, in this comm­ unity. Mrs. Todd is engaged in teaching in the grade school, while Mr. Todd is a student at Wake Forest College. Mrs. John Frank Howard has returned to her home with her baby boy, from a Winston-Salem hospital. fans many headaches. The remaining schedule is as follows: Dec. 8, at Cleveland. Dec. 11, at Churchland. *„ Dec. 15, at Rockwell. Dec. 18, Rockwille at Farming­ ton. Jan. 8, at Cooleemee. Jan. 12, Mocksville at Farming­ ton. Jan. 15 at "Advance. Jan. 29, Advance at Farming ton. of the most bitter fighting on the peninsula. It is now undergoing intensive post-truce training. Private Barker, son of Mr. and Mrs. Tobe Barker, Mocksville, is a tank driver. He entered the .Army in May and completed basic training at Fort Knox, Ky. Mr. and Mrs. James'Thompson and daughter, Betty, of High crling. Selected Short Subjects Saturday, December 5 “THE BATTLE AT APACHE PASS” I with John Lund & Jeff Chandler. Also “BLACK LASH” With Lash Larue Sunday & Monday, Dec. 6 & 7 “From Outer Space” Point, spent Thursday with his' witll R ^ lu ir ^ c S n 1 iT L rbara parents, Mr. Thompson. and Mrs. J. H.Rush Tues. & Wed., Dec. 8 & 9 “THE HITCH - HIKER”Feb. 2, Courtney at Farmington. Feb. 9, Churchland at Farm- ^vith Frank I^vejoy & Edmund ington Feb. 12, Cooleemee at Farming' ton. Feb. 16, at Mocksville. Feb. 19, at Cotirtney. Game time. 7:30. O’Brien SUNDAY MOVIES Shows at 1:30 3:00 9:00 Doors Open 1 p.m. and 8:30 p.m giving day at 5 o’clock, in the j Wake Forest spent the Thanks- Macedonia Moravian parsonage with the Rev. J. G. Bruner offi-' ciating, using the double ring ser- S Thanksgiving. Mrs. Johnny Ward, vice. They were accompanied by i and Mrs. Jesse Liard are in chargei Miss Margaret Nelson and Dar--^ ■ Smont Myers. , ^ Auxiliary Circle Number Two • « met at the home of Marvin Bowles ' ^.. near Maine with Miss Maggie ^ Ellis hos1ess, Tuesday night, Af-jK ter the session, refreshments were j served. |« Mrs. O. R. Dennis has returned j |3 1 from Cincinnatti, Ohio, by plane, ^ « Road, and the Rev. Mr. Bruner.I where she attended the conven-.jj of the lunch room. A large, congregation attended the funeral services for Mrs. Mable Smith, held at Bethlehem ME Church Thanksgiving after­ noon, conducted by the Rev. G. E. Smith of Bethlehem, the Rev. Henry Lewis of New Philadelphia Moravian Church, Country Club TWO NICE HONES To be Sold at Auction Saturday, December 5 (Regardless of Weather) Also, HOUSEHOLD FURNISHINGS, TOOLS, AND EQUIPMENT SALE NO. 1—MOCKSVILLE 10:30 A.M.—PROPERTY OF R. PAUL FOSTER LOCATED at 310 SALISBURY ST. A nice residential section of Mocksville. This home is situated on a 65-foot lot with good garden space and has 5 large rooms and bath. It has been recently painted and is in good condition. Good terms can be arranged. SALE NO. 2—FORK CHURCH f 1:00 P.M.—PROPERTY OF MRS. MOLLIE BURTON located on U. S. Route No. 64 Near Fork Church. A nice, 5-room, one-floor plan, frame home recently mod­ernized, including' built-in cabinets in the large kitchen, and in good condition, situated on’more than an acre of land with long highway frontage. This frontage is very suitable for business. FOLLOWING TIIE SALE OF REAL ESTATE, ALL HOUSEHOLD FURNISHINGS, TOOLS, AND EQUIP­MENT WILL BE SOLD, including General Electric 17” Tele­vision set, knechole desk, Lawson sofa, Gideon electric range, G.E. refrigerator, breakfast set, bedroom suites, living room furniture, and numerous other items. Most of this furniture is practically new and belongs to Mr. and Mrs. Frank Couch who arc moving to Texas....REAL ESTATE will be sold on terms of onc-tliird cash with the balance payable at $50.00 a month with 4 per cent interest. BOTH OF THESE NICE HOMES ARE CONVENIENT TO SCHOOLS, CHURCHES, AND STORES. MANY NEW HOMES ARE BEING BUILT IN BOTH LOCATIONS WHICH ARE CONVENIENT TO WINSTON-SALEM, LEXINGTON, AND SALISBURY (AND, OF COURSE, FORK CHURCH IS NEAR MOCKSVILLE), MAKING EITHER AN IDEAL PLACE TO LIVE FOR ANYONE WORKING IN THESE TOWNS. IF YOU ARE LOOKING FOR A NICE HOME, A GOOD INVESTMENT, OR HOUSEHOLD FURNISHINGS, THEN YOU SHOULD INSPECT THESE PROPERTIES AND ATTEND THESE SALES. DONNELL BROTHERS CO., Oak Ridge, N. C. J. G. SHEETS & SONS, Roanoke, Va. "The Best Investment on Earth is the Earth” Hew to b* a Better Cook ...and save money tool ■» l * | Item Sm tu H oliday timo it candy tim«, and I have a recipe for (he smoothest, richcst-tasting fudge you ever ate. You know that fudge made with Carnation Evaporated M ilk is (he best ever — fudge meeds Carnation! And this recipe is failure-proof— no temperature to watch —no testing in cold water. It’s easy enough for your 12*ycar*old to make —and have pcrfcct results every lime. Make it for the family . . . for gifts. “p u t fy e - < Makes 3 dozco 1* squares) V i d tp (small com) undi’/vfed Car nation Evoporatod Milk 1% cup* sugar Vl cvp d w p p td 1 leoipoon vanlllo \V l cups (about 16 medium) diced marshmallows 11* cups Mini* A CHRISTMAS WONDERLAND of fine Feed Gift Packs to cheese frem ...Exquisite fruit cakes, plum and fig puddings, dried and candied fruits, imported che«Mw fresh fruit baskets, and—extra-fine candies and nuts. chocolate bits CAfiNA7/OA/ M/i/C 3 TALL CANS ...................r........39c 4 SMALL CANS .......................29c - H o i / c f a y - T T m e . P R O D U C E DEL MONTE Pumpkin SUPERFINE—TINY—TENDER Peas VAN CAMP Grated Tuna OCEAN SPRAY Cranberry Sauce 2 cans 29c 23c can 29c can 2 for 45c Combine Carnation and sugar in saucepan. Cook over medium heat few 5 minutes, stirring constantly.. Remove from hear, add remaining ingredients. Th en stir until marshm allows and chocolate are dissolved ( I to 2 mitv s n longer) ■ Pour into buttered square ra n <8* a 6 * ). Cool and ciu into Swansdown 5 lb box CAKE FLOUR 45c Candy Corn.. 29c pkg. a I Novelty Mix HARD CANDY 1 lb. pkg.............32c i CHOCOLATE DROPS | 1 lb.-pkg.............29c | y« 5? Blue Bird g STICK CANDY g 2 lb. box ...........55c | v Chocolate Covered CHERRIES. .. 63c box Merita Light FRUIT CAKE ZV- lb box $2.95 WE HAVE GIFTS FOR ALL THE FAMILY I / f t w V , ENGLISH WALNUTS 1 lb......................35c g COCONUTS, large g size...........19c each jj g ORANGES, large g 216 size.... 2 dz., 49c g g Fresh CRANBERRIES | 29c * . m m Make This Your SPICE Headquarters. We have a complete Sauer’s Spice line BAKE /O U R g i f t DICED CITRON 4 oz. pkg..............18c Diced Mixed Fruit 4 oz. pkg.............19c CHERRIES Vz lb. pkg..........53c FROZEN FOODS Swift BACON....... 1 lb. 69c | Jones’ FRANKS.....1 lb., 47c Jones’ Pure Pork SAUSAGE LINKS 8 oz. pkg............35c Eoned and Tenderized f! ROUND STEAK 59c lb g y Is? CHICKEN LIVERS v 79c pkg. 1v Ia SPV % » V *? y »V w w -9 GIZZARDS....49c pkg. | W’ I CHICKEN PIES.. 3.9c I Sliced 0 SQUASH .... 23c pkg. | 5? Dulany g GARDEN PEAS g 10 oz. pkg ...........20c g « (gis!gi«isigiei5is!ei«!ctg'£«ie!eisi4[i6i6i{5i5igiaisisi€istsi*ie!gig(tieieie(eis:i«isiei«i6!s!e!«i6tei6is!sieteicte*!eiet6,«’«is,e|«l«ls|«,e1e,e|«|«1e>e'si«‘eis‘«isi€!«te!et«teieigigicict«i€i8:i5>«!eigi€ieicietei€ietgiei5i€icisie!cisieigieie S & ONE-HALF GALLON Aerowax st * 9(T,K« 24 PACKAGES Notebook Paper $1 WEST GROCERY W IL K E S B O R O S T R E E T M O C K S V IL L E , 1ST. C.g PAGE FOUR THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 3,1953 | Fork Tim and Vickie Davis of Win­ ston - Salem spent last week end with their grandparents, Mr. and Mrs. J. M. Davis. Mr. > and Mrs. Clarence Lven- good of Wilkesboro spent the week end here with friends and relatives. Mr. and Mrs. John Hege and small daughter of Charlotte are spending some time here with relatives and friends. . Mrs. Treva Spillman spent the past week end in Atlanta, Ga., with her sister, Miss Nell Liven­ good/ Cecil Smith, son of Mr. and Mrs. John Smith, is still a patient at Baptist hospital, Winston-Sa- leni, suffering with rheumatic fever. Alvin Carter and family, Bobby and Toby Lewis of Avery Coun­ ty spent the Thanksgiving holi­ days with Miss Annie Carter and other relatives. Saturday evening visitors of Mi', and Mrs. Vance Johnson were Mr. and Mrs. Joe Johnson of. States­ ville, Mr. and Mrs. W. A. Allen, Jr. ,and son, Clevie; and Pvt. Rich­ ard Wyatt, Baltimore, Md. Mr. and Mrs. James Ratledge of Winston - Salem, Mr. and Mrs. Worth Potts of Reeds were Sun­ day afternoon, guests of their mother, Mrs. Agnes Franks. Mitchell Carter and family of High Point, Mr. and Mrs. Walter giving holidays were: Carmen’ Miss Mary Ann Bass in Durham. Sowers and chifdren of Reedy Greene, WCUNC; Mary Kiser,! Mr. and Mrs. Carey Williams Creek visited Miss Anne Carter Meredith; Bob Greene, East Car- 0f Winston-Salem were Sunday | the past week-end. lolina; Aubrey Fleming, of Gas- guests of Mr. and Mrs. Ned Bail- “ Mr. and Mrs. Frank DeParle of ton Technical Institute; and Jerry ey. Summervlle, S. C., spent Thanks- Gobble and Derry Barnhardt of Mr_ ^ Mrs 0Us Bo,es Qf Bq1_ timore, Md., spent the week end with her parents, Mr. and Mrs. J. N. Richardson. giving holidays with her mother, ORMI. Mrs. Nina Hoyle, and other rela- Mr, and Mrs. Grover Robertson tives. j of Lexington were Thursday Sunday guests of Mr .and Mrs. guests of Mr. and Mrs! Robie Z. V. Johnson were Mr. and Mrs. Jarvis. Mrs. Beulah Foster of Hanes Carl Johnson and daughter, Car- Floyd Sidden of Wnston-Salem visited Mrs. I. C. Berrier over ol; Mr. and Mrs. Fred Murdock spent Thanksgiving here with the week end. and Mr. and Mrs. T. F. Benge, his brother, Byerly Sidden. all of Statesville. 1 ' „Misr.es Carmen an d Edrie The Turkey Supper and Ba- Greene, accompanied by Miss Le- zaar sponsored by the WSCS of na Cornatzer of Mockksville and Fulton Methodist Church was Miss Marty Yow of Greensboro, very successful. The sum or $140 attended the Duke-Carolina game • was made above expenses. j Saturday at Duke Stadium. They Students home for the Thanks . were Saturday night guests of Concord The W. S. C. S. will meet with Mrs. Van Swicegood Saturday, at 2:30. Those visiting Mr. and Mrs. S. D. Daniel Thanksgiving Day were Mr. and Mrs. Bud Foster and Anne of Cooleemee; Mr. and Mrs. Raymond Daniel and daughters, and Mr. and Mrs. Sam Daniel and family of Liberty; Hoot Daniel and Wayne of Franklin; Mr. and Mrs. John Walker and sons and Mrs. James Boger of Mocksville and Mr. and Mrs. Everette Sea­ mon and son of Turrentine. Mr. and Mrs. W. R. Davis, Mr. and Mrs. Junior Sechrest and family and Mr. and Mrs. J. N. Tutterow and son visited Mr. and Mrs. Duke Tutterow, Sunday af­ ternoon. Santa Claus has been to Miller-Evans Hardware with a wide selection of Gift Items “A GIFT OF FURNITURE IS A GIFT THAT WILL BE REMEMBERED” GIFTS UP TO $50 Desks Telephone Benches Cedar Chests Hollywood Beds Desk & Chair Sets Mattresses Rugs Chairs of all Kinds Floor Lamps 3-Way Lamps Traffic Appliances Tables of ; all Kinds Radios . 2 Phonographs J'/' GIFTS UP TO $5 Table Lamps Carpet Sweepers Pictures Lamp Shades y Boudoir Lamps Smokers | End Tables » Lamp Tables | Throw Rugs | Child’s Rockers g Hassocks % v s?v $ §fife— GIFTS UP TO $25 Radios Record Player | Telephone Benches Bookcases Appliances Wardrobes Floor Lamps Table Lamps Record Ciabinets Cribs GIFTS UP TO $15 Table Lamps; Vanity Lamps Student Lamps Mirrors Pictures Cocktail Tables Lamp Tables GIFT3 UP TO $10 Table Lamps | Vanity Sets High Chairs ' I Play Pens Chrome Chairs Smokers Mirrors ; ’ Venetian Blinds Pictures Traffic Appliances Card Tables vwaa:VV | Coffee Tables End Tables Tier Tables Adaptable Tables Throw Rugs Linoleum Rugs | Traffic Appliances | 8 I I -| Throw Rugs Iif*U Hassocks a y w w y »I » y Traffic Appliances Boudoir Chairs Pull up Chairs | Cricket Chairs | Telephone Sets Vg Sewing Cabinets IJust the Gift for HER! | A Lane Cedar Chest YOU CAN BE SURE WHEN YOU GIVE | • Westinghouse • IM rtandsotr.e waterfall de*I|tn in rich American wrJnut—big 48" *i*c, Has iclf-risiuy tray, $49.95 ONE CE M E N T SAVED PAYS FOR • WESTINGHOUSE REFRIGERATORS Q WESTINGHOUSE RANGES • WESTINGHOUSE LAUNDROMATS • WESTINGHOUSE CLOTHES DRYER • WESTINGHOUSE TELEVISION SETS • WESTINGHOUSE IRONERS • WESTINGHOUSE ROASTERS e WESTINGHOUSE RADIOS All Types of Westinghouse Small Appliances such as WAFFLE IRONS—PERCOLATORS — IRONS — TOASTERS — SANDWICH GRILLS. ------TERMS ARRANGED TO SUIT YOUR CONVENIENCE------ t Davie Furniture Co. Phone 72 ‘On The Square”Mocksville Radio Super Wagons ....$5.50 Radio Fyler Wagons ....$9.50 Radio Town and Country Wagons....................$17.95 Murray Tractor.........$26.95 Tricycles ...................... $6.95 Dump Truck .............. $21.95 Five Truck ................ $19.95 Costello Tractor ....... $18.95 Taylor Tot Strollers ....$11.95 Flite Master GYM SETS—8 play set............................$35.00 Cummins “DO-IT” WORK SHOP Vx in. Black & Decker DRILLS 6 in. Black & Decker POWER SAWS % in. Black & Decker DRILL KITS HAMMERS WRENCHES AUGER BITS HAND SAWS TO BRIGHTEN THE HOME for CHRISTMAS WE HAVE A COMPLETE LINE OF FLAT, SEMI-GLOSS AND ENAMEL PAINT. SUPER KEMTONE—BRU-TONE—BELKNAP. Miller - Evans Hardware Co. —At Intersection of Yadkinville and Statesville Highways— Phone 65 Wilkesboro St. Mocksville, N; C. i$i STARLET Expansion Bracelet AMERICAN GIRL 17 Jewels *5750 lilt iu llu llis PRESIDENT WEMBLEY 21 Jewels 17 Jewsls Expansion Band 14 kt. sold*495# * 7 p See ou r co m p lete selection o f fine jew elry gifts Foster Watch Shop "O N T H E S Q U A R E " Mo c k s v il l e , N . C . Konson Lighter $5.95 up a fllff LINKS ' $1.50 up Filets include ftdertl tax THURSDAY, DECEMBER 3, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE PAGE FIVE '"Ol'iitt'. V • A . FROM A GRAND NEW SELECTION AT BELK-HARRY GIVE HER SHEER, BEAUTIFUL NYLONS . : McCRARY NYLONS* j "The Stocking With the Arrow" Lovely New Shades: Fiesta, Twilight and Amor 51 Gauge, 15 Denier. . ,$1.25 51 Gauge, 30 Denier.,. ,$1.25 60 Gauge, 15 Denier. . .$1.35 60 Gauge, 12 Denier. . .$1.65 HOSIERY . . . STREET FLOOR jm m a K s m B m m m m m a m tm m m m m M M m CORDE & FAILLE GIFT HANDBAGS A Host of Smart. New Styles Black, Brown and Navy *4.95 . Hansen, Dawnelle and Fownes GLOVES o ■ i'Smarf^double-woven cottons arid white doeskin. ''.Black, white and beige and navy. \ $1.98 to$3.93 STRING, WOOL AND ANGORA GLOVES White, pastels and dark colors. *• *1 .oo to *3.50 WONDERFUL "HOMEY" GIFTS From Our Basemen fr Gift Department A Large Assortment LAMPS Boudoir and Table Lamps ' Suitable for every type room., ■ *1-98 to *35-00 PICTURES All sizes. Landscapes, Florals, Birds, etc. Square, ovals and rectangles. GIFT BRASSWARE A really grand assortment. Placques, planters, trivets, mail boxes, book ends,> waste baskets,; , footed bowls, etc. •, *1.48 to s14-95 ATTRACTIVE PUNCH SETS *9.95 to‘14.95 A Wonderful Collection BOXED PINS and EARRING SETS By Karu and Coro * 2 - 0 0 ■■ Gift-Boxed WILLIAM RAND PEARLS *2,00 Lovely Hand-Painted TRAYS Assorted sizes and colors. *1.00 to *4*98 Hand-Painted Munising WOOD SALAD SETS *8 9 5 Fabulous Costume Jewelry By Schiaparelli Gold, Silver and Rhinestone $3.98to*9.98 COROTEEN COSTUME JEWELRY For Children ‘ 1.00 , FIREPLACE ACCESSORIES Polished’Brass and Combinations FIRE KETTLES.... $5.95 to $9.95 WOOD BASKETS $5.95 - $12.95 FIRE SETS.............$10.95-$14.95 ANDIRONS... .$5.95 to $14.95 BASEMENT STORE A Fashion Hitl ATTRACTI VE NEW COLLARS Tailored washable pique and fancy, dressy collars of satin.and velvet; pearl and braid trimmed. M-0Q ACCESSORIES STREET FLOOR Fur-Trimmed Quilted Satin SLIPPERS *1.93 HCUSE SHOES SIOUX MOX SLIPPERS BY TRU-STITCH Richly furred hand-beaded capeskin. 8 Lovely Colors *2-98 Also Children's Sizes................... *2.98 Leather Sole, Rubber Heel FELT HOUSE SHOES *1.98 Fur-Trimmed Metallic Brocade SLIPPERS $2-98 Soft, Padded Soles FELT HOUSE SHOES *1.50 STREET FLOOR . FOR EVERY GIRL AND BOY DOLLS OF ALL KINDS IDEAL— AMERICAN CHARACTER — MADAME ALEXANDER — EFFANBEE — NANETTE . • WALKING DOLLS — TINY TEARS HOLSTER SETS TOY TELEPHONES REFRIGERATORS TEA SETS BLOCKS PULL TOYS PIANOS IRONS & BOARDS • ROLLER SKATES • TINKER TOYS • STOVES • SINKS • BAKING SETS • TOOLBOXES • DRUMS • MUSICAL TOYS • STUFFED TOYS BASEMENT STORE SALISBURY, N. C. A SMALL DEPOSIT WILL HOLD TILL CHRISTMAS PAGE SIX THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 3,1953 Oak Grove Mrs. Beulah Whitaker and Ed­ gar Whitaker, Mr. and Mrs. C. B. Boger and children were supper guests of Mr. and Mrs. Lee Whit­ aker Wednesday night and Lee went with them to South Caro­ lina. Mr. and Mrs. Tom Rua and son, Mr. and Mrs. William Doty iof Winston-Salem visiled Mrs. ■Calvin Bowles Sunday. Mr. and Mrs. Janies Summers Tid-Bits By GORDON TOMLINSON Bob Dwiggins would qualify as a very enterprising salesman for Bixby any firm. Now in December, 1953 he is selling 1953 calendars for There will be a prayer service followed by choir practice Fri­ day night at 7:30, at the Bixby MHS News By ED ROWLAND Pino .The basketball schedule has started for the Mocksville Wild­ cats. The first game was played (Tuesday night, and a complete summary will be in next week’s paper. West Yadkin's strong team' will play here Friday night. Game Presbyterian Church. Mrs. C. C. Walker and Mrs. 19c each and reports quite a few DR'vev Robertson are still on our sales. jsick list- "It is a bargain,” he said, “121 J- C. Massey, student at Wake! time wil, be 7.go students and months ago one of these cnlen-■Forest Col.ege spent the Thanks-1 adu]tS) come out Qnd seg ir dars would have cost you 50c.” p'v'nR holiday? with hs parents, 0j goocj basketball games. “But,” said 1, "1953 is almost, Mr- and Mrs. Joe Massey. | .spent Friday in Winston-Salem Sone. 1954 is almost here.” | Miss Vada Hilton spent the Co-captains and managers were •shopping. . I “But,” said he, “these calendars week end in Lexington-with her choren at meetings held by the Mr. and Mrs. O. F. Doty and are just as good as new. No one sistnr- Mrs' ottis Coppley. | two basketball teams Monday, children of Winston-Salem spent buys them to keep track of the J- E. Maddox spent Thurs- The girls’ captain is Lena Corn- Thanksgiving with Mr. and Mrs. days or weeks anyway. They buy r'av and Friday in Charlotte on steer. She is a starting forward, Mr. and Mrs. Harold Grientert and son, Harold, Jr., also his par­ ents of San Antonio, Texas, are spending two weeks with Mrs. W. W. West. Mrs. Harold Gruientert is the former Miss Jessie West. Mr. and Mrs. Gilbert Reavis and son, Randy and Mr. and Mrs. Romie Reavis spent the Thanks­ giving holidays with friends at Myrtle Beach. Mr. and Mrs. Harmon McMa­ han spent Thanksgiving with Mrs. Hugh Dixon in Pleasant Garden. Charles Leckie, Mrs. Grace Ter­ rell of Wilkesboro, Mr. and Mrs. A. M. Davis of Winston-Salem,' Fletcher Redmon of South Car- I olina were recent visitors ’of Mr. j and Mrs. L. L. Miller. |\ The Friendly Book Club will I meet Wednesday, Dec. 9, at 2 o'­ clock with Mrs. Odell James. . ROAD HEARING ON DECEMBER 9 Public hearing for road re­ quests has ben scheduled for 10 a.m. at. the court house in Salis­ bury, Rowan County, on Wednes­ day, December 9. James A .' Gray, Jr., Commis­ sioner of the Ninth Highway Di­ vision, states that they will be prepared to hear requests for any of the counties in this divis­ ion at that time. Ray McClamrock. Mr. and Mrs. William Summers have moved into their new i home. - Carolyn McCulloh spent the Gjrjs» calendars. holidays with her grand mother, ■ ____! Mrs. J. H. Angell. them for the art sake and at 19c bu-'iness, thev are a very good buy.” and a junior in her third year of , varsity competition. Dreisa Bar- Looking at them I had to agree. stationed” a f Fort^Bragg, ^spent WaS chof e.n man!lgel'; They were the famed “Esquire week end with his mother ,, ys co‘ caP ains are Robert La- Oirls” calendars ™ a • ~ mother, tham and “Buck” Winters. Robert An™ Cl'°'VS- ' n , ' is a senior, a veteran of three^ rs. j . £i, Angeii. _ I The passing °f Thanksgiving'years' action, and a very active Mr. and Mrs. W. R. Beeding u„.here(J in the Christmas season BeSuchamo owr the ' g6 UCk Winters ls,of Smith Grove and Mrs. Will-1 ltv Mnck,viUe as well as most Thanksgiving a junior, a player since the eighth1 • " -........................... y • ' grade, and a smart, fast little for-iiam Beeding of Cornatzer was Saturday night supper guests of • • • •••« Our Present Policyholders Are _ Saving up to 25% MYou Get Low Cost—Broad Coverage Auto insurance Protection For Your Dollar •..with State Farm. “I have show n m any autom obile drivers how to save m oney the State Farm w ay. Ju st give m e the o pportunity to prove to you the m oney saving advantages of th e u n iq u e -d iffe re n t ' insurance p lan pioneered b f State - • CLIFFORD REAVIS Mocksville, N. C. - Phone 118 '} ' .Office in Anderson Bldg:. ST Aft k 'B M JMHBM AlHOMfe. 'U msiMANa co. Bloomington, Illinois Prixe suede for smart stepping in Vim JSeks O lh tr Slyltf «• M O ” B E L L SHOE STORE SALISBURY, N. C. everywhere else. The first part of 'his week most every firm in town, was up Christmas displays and holi- most every urn. in ^ ward. Charles Messick and Rameyevery urm in vls,te(j j^r. and Mrs. J. H. Rob- v-omr, ~busily engaged putting _rtsnn W. pll. pnH Kemp aie the managers. up ^nnsunas aispiays ana nou-, Mr. and Mrs. R. L. Beauchamp, T\/r„ ^ day decorations. And it is rtone Mr- and Mrs ottis Coppiey, M r.iM r - a n d M r s - B o w d e n ' too soon, for as of Thursday only 18 more shopping days remain un- ':il Christmas. « The man believed to be res­ ponsible for most of the break-ins that have occured around in this communitv\vas caught Monday nir’ht''in Winston-Salem. Failure .o patronize a tonnorial parlor gave him features easily resog- and Mrs, e. f . Coiiins and Mr.: Have Dinner Sunday and Mrs. Jimmy Plemmons visit-1 Mr and Mrg L g Bowden save a dinner Sunday at their home on Depot Street. ed Mr. and Mrs. R. A. Hilton Sun­ day. Mr. and Mrs. Turner Robertson and family and Mr. and Mrs. C. A. Robertson and family spent Thursday with Mr. and Mrs. S. J. Robertson. Mr. and Mrs. Tommy Latham visited Mr. and Mrs. Sanford . . . . . . . ... , -J Massey over the week end.This episode might readily lead i „ _ 3i j t- { „ ___„„ J Mr. and Mrs. F. M. Robertsonto the adoption of a slogan by the . .. „ . i.. . spent the week end at their home barbershops. It might read like B= b •this: I _ _ “Rich man, poor man, beggar man, thief . . . it will pay you to visit your barber regularly.” Schedule Given For H. D. Club Meetings Sheffield Mr. and Mrs. Charlie Reeves and family and Mrs. S. L. Reeves „ . ... . visited Mr. and Mrs. CharlieSmith Grove Club will meet Brogdon in Greensboro Thanks. on Tuesday, Dec. 8. at 7:30 p.m.1 givjng_ Ho'-tnssfis: Mesdames Paul Bowles and Richard Allen. Meeting place will be announced later. Bailey’s Chapel Club will be Mr. and Mrs. Claude Wooten and daughter, Linda, shopped in Winston-Salem, Saturday. Mr. and Mrs. Garfield Lapishhostess to Advance-Elbaville club j ,n r J J „ n , „ and daughter of Mocksville spent on Wednesday, Dec 9 at 2:30 p Thanksgivng with her m o » m . The meeting will be held at MrSi Linco)n Richardson> Bailey’s Chapel Church Misses Mary Lou and Kather_ Kappa Club .will meet m the ine Reeves spent the week end the community building on Thurs- / +Vie dinner were: Mrs. D. P'c'-ens, Miss Louise Pic!:~ns rnr’ Misses Eliza and Nan! J)oii<''H of Charlotte; Ralph Bow­ den of Chapel Hill and Mrs. A. E. Hcrtman and Mrs. E. H. Morris. Guests of Mr. and Mrs. Homer Latham for Thanksgiving dinner were: Mr. and Mrs. W. S. Coll­ ette, Mr. and Mrs. L. G. Wall­ ace and son, William Gray, of I Rt. 2; and Mr. and Mrs. Clark Keller, John Shouse, Mrs. J. O. Etchison, Mrs. Bobby , Messick, in Greensboro. Mr. and Mrs. Junior Wright of East Bend visited Mr. and Mrs. John Wright Sunday. Mr. and Mrs. Elmer Wooten of , Mocksville visited Mr. and Mrs.' Gaither Wooten Sunday. , Mrs'. Allen Gaither spent one' day last week with her daughter, Mrs. Leroy Dyson. Mr. and Mrs. Wade Wright spent. Thanksgiving with her parents, Mr. and Mrs. W. L. Reeves. day, Dec. 10, at 2 p.m. Hostesses: all club women. Mocksville club will meet on Thursday, Dec. 10, at 7:30. Hos­ tesses: Mesdames Roy Brown, Sr., Roy Brown, Jr., W. Q. Grigg and Miss Mary Heitman. Meeting place will be announced later. Miss Geneva Bailey Weds John B. Anderson Miss Geneva Bailey, daughter of Mr. and Mrs. Charlie Bailey, became the bride of John Burley Anderson Saturday afternoon at two o’clock in a double ring cere­ mony performer at the home of the officiating minister, Rev. E. W. Turner.. Everything for Christmas Available Now . AVOID DISAPPOINTMENT LATER . . . , MAKE YOUR SELECTION NOW ON OUR LAY AWAY PLAN KVvtsvvmvwvvmvmKvvvmKtctcicicintrcwicicmicicwtctctcvtctcici Mr. and Mrs. Roy Williams. Mr. and Mrs.' W, K. Whitaker and grand daughter, Elaine, were Thanksgiving dinner guests of Mr. and Mrs. J. C. Griffith near Statesville. Mrs. George Dollar of South Carolina visited her parents, Mr. and Mrs. T. C. McClamrock, last week and Mary Jane returned home with her for the week end. Mrs. Sallie McDaniel had her children home for Thanksgiving dinner. . Mrs. iMary Horn and family of Kannapolis and Mr. and Mrs. Johnny Stafford and family of South Carolina visited Mrs. Lee Whitaker Saturday. Mr. and Mrs, Lewis Latham of Elkin visited Mr. and Mrs. Will Beck, Sunday afternoon. Watch Bracelets Earrings Pins Solitaries Dinner Rings Wedding Rings t IaMrtKKKKKaKAKAAXaKa J E W E L R Y Necklace and Earring Sets ■ Rhinestone Earrings Rhinestone Braclets i>e>ci(>sici(ic<c«ixc>f>cici(i(ic<cic<( tctg!gi««'c<«!c>ete)ctctcietctcic!ctc« Elcctrical Appliances Toasters - Waffle Makers - Mixers - Percolators I 1ftII 3 §Ii a $ I£ NORTH MAIN ST. SALISBURY! N. C. . time) THURSDAY, DECEMBER 3, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE PAGE SEVEN ^ V .W .\ \ V ., .W .V A V \ % % W .V .,.W /.% W iW .W .V .% \ W A ; ^ W .V .V A W .W .V W W W V .V A V .V .V .V .W .V A W Mrs. W. M. Long and Mrs. W. I. Howell ot Hamlet spent Mon- • day through Wednesday in At- ' lanta, Ga. Miss Willie Miller accompanied ' Mr. and Mrs. John Durham to ’ Mooresville, Wednesday to visit ' her sisters, Mrs. Herbert Birdsall and Mrs. Price Sherrill until ’ Sunday. The Durhams ->were the ■ guests of Mr. and Mrs. Pars Lem- • mond in Matthews,, Wednesday and Thursday. Miss Guthrie Lem­ m ond returned home with them for the wfeek end, Ralph Bowden, student at the 'Universiiy o'f North Carolina, spent the Thanksgiving holidays ■ with his parents, Mr. and Mrs. L. 'S. Bowden. Miss Jean Byrd of Greensboro ■ and ' Mrs. George Byrd of Chil­ dren’s'Home were holiday guests of Mrs. 'Ollie Stockton. Mrs. Vance Kendrick and chil­ dren, Zeb and Clement, of Char­ lotte - were week end guests of her mother, Mrs. J. Frank Clem­ ent. Mr. an’d'Mrs. W. T. Yancey and Miss. Sarah Clement of Oxford spent“Fri'day afternoon here with relatives. - Harry Childress, of Richmond, Va., was a week end guest of his sister,'Mrs. Henry Taylor, and Mr. Taylor. Tyler "Luney spent Thursday in Roanoke, Va. Mrs. .Luney and daughter who have visited her! parents the past three weeks re­ turned home'with him. Pvt. "Lawrence Ray Carter ar­ rived Thursday from Fort Mon­ mouth, N. J., to visit his parents, Mr. and Mrs. Hasten Carter, un­ til Sunday. 'Mr. and Mrs. E. P. Ellis of "Winston-Salem visited her par­ ents, "Mr. and Mrs. C. R. Horn, Friday night. Miss Carol Johnstone visited in 'Roanoke, Va., Wednesday and Thursday. She attended the PMI- VMI football game. Dr. and Mrs. L. P. Martin spent Thursday in Wake Forest, the 'guests of their son, L. P. Mar­ tin, Jr., and Mrs. Martin. Mrs. C. A. Tutterow spent the Thanksgiving holidays in Albe­ marle, with relatives and friends, Mrs. Ollie M. Vernon left Mon­ day for her home in Bryan, Texas, ■after spending the past two weeks •with her mother,, Mrs. W. J. Mr. and Mrs. Marvin Waters, "Miss Anne Kurfees, Johnny Ma­ son' and Mrs. Elizabeth Tinker spent Thursday in Greensboro, the •guests of Mr. and Mrs. Paul Rock­ ett nnd Friday with Mr. and Mrs. J. D. Potts in High Point. Mrs. Potts and son, ,Greg, qnd Mrs. W. P. Amos and son, Pat, and Buddy Hockett returned home with them for the week end. Miss Nancy Latham returned to ASTC,. Boone, Monday, after spending the past week with her parents, Mr. and Mrs. S. R. La­ tham. Thursday guests of the Lathams were their daughter, Mrs. F. B. Shore and Mr. Shore of Win­ ston-Salem. Guests of Mr .and Mrs. J. D. Purvis from Wednesday until Sat­ urday were his mother, Mrs. E. L. Purvis of Norfolk, Va., and his sister, Mrs. L. R. Ishee, Mr. Xshee and daughter, Charlotte, of Poco- rnoke, Md. ' Mrs. L. G. Sanford, Mrs. L. E. Feezer and Gaither and Ade­ laide Sanford heard Gina Bach- auer, pianist, play Thursday even­ ing at Duke University, Durham. Thursday dinner guests of Mr. and Mrs. G. N. Ward were Mr, and Mrs. Marshall Kurfees of Winston - Salem and Jack Ward of Salisbury. Their guests Sun­ day afternoon were Dick Cann- ady and Miss Anne Walters of Salisbury and Art Turner of Le­ noir. Mr, and Mrs. J. P. Legrand visited relatives in Barnwell and Allendale, S. C., from Wednesday until Sunday. Mr. and Mrs. Harry Osborne and Harry Osborne, Jr., spent the Thanksgiving holidays in For­ est Ci!y, the guests of Mr. and Mi's. Timothy McKeathan. I • Mis. George Messick, Mr. and Mrs. Gilbert Atwood and children, Constance, Jimmy and Bonnie, will leave Friday for Baltimore, Md., to attend the weddng of Mrs, Messick’s son, James Baker,! which will take place on Sunday, Local Girl Honored December 6. . _ « . 0 , . Dr. Bill Sanford arrived .Thurs- A t G e o r g ia behO Ol day from Baltimore, Md., to visit Miss MavjoriCj Foster, above, his mother, Mrs. J. C. Sanford un- daughter of Mr. and Mrs. Odell til Sunday. ) Foster of the Fork community, Jack Sanford and a group of has been elected a« “Sweetheart friends from Ohio and New Jersey ', of the FFA” at the Berry School, will duck hunt at Currituck this Mt. Berry, Georgia. Miss Foster is a sophomore at the Berry Shools. She enrolled at this school at the beginning of the second semester last Jan­ uary. Prior to that time she at­ tended the Shady Grove School She is also secretary of the Student Council and served as president of the Berry High H. C. Shutt, Mrs. E. S. Bowman | School Sunday School during the and Mrs. Margaret A. LpGrand summer session, heard one of the -principal key- K e e p s its v a lu e b e tte r th a n a n y o th e r c a r ! week end. Sgt. and Mrs. Glenn Morrow and daughter, Marty Jo. of" San Antonio, Texas, arrived' Wednes­ day to spend a 30 day leave With her parents, Mr. and Mrs. L. S. Bowden, Sr. ■ ( Mr. and Mrs. P. J. Johnson, Mrs. J. Frank Clement, Mrs. G, . 1 __ board artists of today, Robert Miss Betty Sue Barney Goldsand, in a piano recital Tlr , T , o /-< ^/Tonday evening in the Boyden W e d s In C h e ste r, o . U . High School auditorium. Mr. and Mrs. Sheek Bowden, Miss Betty Sue Barney and Carnoll Dean James were united P rin ce ssT lie a tre Tliur. & Fri.i "TAKE THE CSOUND” Technicolor, with Richard Widmark. Also Latest NEWS. Sat. “CITY OF BAD MEN.” In Technicolor with Dale Rob­ertson & Jeanne Crain. Also Cartoon & Serial, Mon. & Tucs.: “THE ALL AMEU’ CAN" with Tony Curtis & Lori Nelson. (Foo ball Fea­ture) »Also Cartoon & News. Wed. “THE GOLDEN BLADE" In Technicolpr with ltock Hud­ son & Piper Laurie, Also Car­ toon and Comedy, Phone 182 for Show Time Jr., moved Monday from Spring in marriage. Sunday, November Street to their recently erected 29, in Chster, ■ S. C.. home on Wilkesboro Street. | Mr. and Mrs. Tommy Lagle and Week of Prayer ' for foreign Mr. and Mrs. Charles James ac7 missions began Monday evening companied them to Chester for at the First Baptst Church. Pray- the ceremony. er services will be held each evening at 7:30 through the week. H. B. Koontz of Walden, N. Y„ Mrs. James is the daughter , of Sam Barney and the late Mrs .. , ..... Barney. Mr. James is a son of Mr.is spending three weeksiw. h h.s m i Mrs_ Carl James of R t 4> parents, Mr. and Mrs. Taylor F. Koontz at Fork. Mr. arid Mrs. W. J. McDonald of Rt. 2, were Thursday dinner! guests of their son, James Mc­ Donald, and Mrs. McDonald in Burlington. Fifteen other guests attended the dinner. Mr. and Mrs. R. G. Dyson of Taco, Montana, Mrs. H. C. Bar- The couple are making their home with her father on Rt. 4. Mr. and Mrs. Angell Are Hosts At Dinner Mr., and Mrs. C. J. Angell en­ tertained at a turkey dinner Thursday at their home on Salis- neycastle and two children andj bury Street. Mrs. George Boger of Route 3, Places were set for -.M r. and were Sunday dinner guests of Mr. Angell, Mr. and Mrs. Jack and Mrs. Alvin Dyson at their. *-*• Daniel of Wnston-Salem; Mrs. home on Route 4. R- H- Neal of Madison; Mr. and Mrs. H. H. Neal, Miss Betty An- Mr. and Mrs. J. W. Hill Are Hosts At Partv Mr. and Mrs. J. W. Hill enter­ tained at a party Saturday, even­ ing at the Hotel Mocksville, hon­ oring people who have recently moved to the city. Games and contests were play­ ed with prizes going to Rev. Paul H. Richards and Miss Louise' Stroud. A poem “Say It” by B. W. Spillman was read by Mrs. Hill | after which ice cream sundaes and coffee were served at tables centered With minature rock gar­ dens flanked by yellow and green tapers in crystal holders. Guests included: Mr. and Mrs. Leonard Cathy, Mr. and Mrs. W. L. Collins, D. A. Russ, Miss Sherr-' ill, R. C. Basinger, Mr, and Mrs. R. B. Hall, Mr. and Mrs. Bryan Sell, Dr. and Mrs. Henry S, An­ derson,, Rev. and Mrs. Paul H. Richards, Misses Louise and Jessie Libby Stroud and Mrs. J. C. Little. Mr. and Mrs. Sanford Observe Anniversary " Mr. and Mrs. J. .S. Sanford en­ tertained at a dinner Thursday evening at their home on South Main Street observing their third wedding anniversary. Covers were laid for: Mr. and Mrs. Sanford, Mrs. J. C. Sanford, Dr. Bill Sanford of Baltimore, Md., Mrs. A. M. Kimbrough, Jr., and daughters, Betty and Helen, and Judy and Peggy Sanford. T. I. Caudell Gives Family Dinner T. I. Caudell was liost at a fam­ ily dinner'Thursday at the home of his daughtpr, Mrs. Bill How­ ard, and Mr. Howard on Oak St. The home was decorated for the! occasion with artistic arrange- men‘ s of colorful chrysanthe­ mums. Covers were laid for: Mr. Cau­ dell, Mr. and Mrs. Howard, Mr, and Mrs. W. fa. Caudell of Char­ lotte, Mr. and Mrs. T. J. Caudell, Mr. and ’ Mrs, W. C, Daniel and daughter, Margaret Ann, Mr. and Mrs. Sam Howard and daughter, Jane, and Mr. and Mrs. W. M. Crotts. gell and Alton Carter. U s e d c a r d e a l e r s r e p o r t t h a t F o r d s r e t u r n m o r e o f t h e i r o r i g i n a l c o s t t l i a n a n y o t h e r c a r — a n d t h e r e a r e 4 1 r e a s o n s w h y : T a k e p o t v e r . Ford’s two high-compresston engines are real leaders in their class. Ford’s the only car in the low-price • field to ofTer you the smooth power of a V-8 engine. And no other car in any field has so modern a Six. l a k e b u i l d . Ford’s one-piece Crestmark body gives you style-setting beauty witli rugged "build” underneath. Where many other cars are bolted, Fords arc welded hull-tight to keep out rust-causing weather and dirt. T a k e r i d e • Ford’s wonderful, new ride reduces front end road shock up to 80%. And Ford’s new, more responsive spring and shock absorber action gives you the comfortable'easy ride you want without gas-eating extra weight. T a k e s a v i n g s . Ford’s economy-minded Automatic Power Pilot saves you money on every gallon of gas. It automatically adjusts carburetion, ignition and combustion to make every drop of ga& ("regular” at that) work its heart out*. T a k e v i s i b i l i t y . Ford gives you the "all- around” view you need in today’s fast-moving traffic. A curved one-piece windshield, car-wide rear window and large "picture windows” all around make sure you have Full-Circle visibility. T a k e d r i v e s • Only Ford in its field gives you a choice of a completely automatic drive, Fordomatic, the finest, most versatile automatic you can buy . . . fuel-saving Overdrive • • • or easy-shifting Conventional Drive. WORTH MORE WHEN YOU BUY I T ... WORTH MORE WHEN YOU SELL IT! r .o .A .r * Sanford Motor Company Telephone 77 —“YOUR FORD DEALER SINCE 1913”—Mocksville, N. C. Come R unnin’ • This is our Big S T O C K • Men’s Suits “After Thanksgiving” R E D U C I N G S A L E Now you do not have to wait until after Christmas to get a real suit bargain, wool GRIFFON and SEWELL Suits. Values to $54.50-. On Sale from now until Christmas,. 40 all Sale Price Vs off ANY AND ALL OTHER SUITS — SEWELL AND GRIFFON .................. ........................................... 10% OFF t«ieicicicieisicicic«isieteiete«<etcici<ic«!ci(ici«cie<c<c>c‘c>c<e<c«>e««‘e«<e‘e«<c<c‘e«‘e‘(<c>c«<c<<«««ic«t(««««i(!e>c>c>c>e>c«<(c«%>c«>««e«<(«««>e«>c>eieie!sictst£ic!s>e!e««ie<ei(>c<ctc««>e>c«« One lot of Ladies Suits Values to $49.50 NOW Vz Price One lot of Dresses Values to $16.50 NOW $5 One lot Ladies Hats Formerly $4.95 NOW $1.98 f t*ie*teiaiei8i«i5ifiieietsiei6,-sie!ci«it:,ei«iei€i«i€«i«ia!cteie«ic!«!«s?*!*ias,s»a>‘l!s!9,s,3,sis,s,*isisis,sisi9,s,s,sis,9,* s,sjs,9,s,3,®,9>2af(3iafca3i»asi3!sia3ia2isi>isj9iasis/5iasi>(3i9jas)a»i3is)»is)sis One lot of Ladies and Misses Dresses Values to $25.00 NOW Vz Price Ladies, Misses and Children’s Coats and Suits V Reduced 25% Ladies | Nylon Hose | M Lovely shades, all sizes, value $1 M. t . NOW 87c I THIS IS THE STORE OF BETTER VALUES—ON THE SQUARE SINCE 1867. WE GIVE S & H GREEN STAMPS —DO YOUR CHRISTMAS SHOPPING HERE— C. C. Sanford Sons C om pany PHONE 7 MOCKSVILLE PAGE EIGHT THE MOCKSVILLE (N. C.) ENTERPRISE .THURSDAY, DECEMBER 3,1953 MORE ABOUT “ FOLLOW ME” Testament writings. The brilliant writer of Isaiah had expressed it, “All wo like sheep have gone astray; we have turned everyone to his own way; and the Lord has laid on him the iniquity of us all.” (v. G). Therefore, Christ becomes more than a guide; He becomes a protector, a providor, and a keeper and possessor. A third implication in the text 5s that life requires not only a guide through its mazes and labyrinths but also ideals and ob- .pectives in life. There must be| high aims and goals. The Master acquired the name of Rabbi, or Teacher; and both the master of His teaching and His methods placs Him at the top rank among the world’s teachers. But it should be noted that the supremocy of His teaching doei not inhere sole­ ly, or even chiefly, in the mater­ ial and method of His teaching. He taught by His example and by His spirit also. Therefore, to be a disciple of Christ is not only to accept His teachings but to accept Him in person. Finally, to "foL’ow Chri'-.t" in fulfillment of the text, is not only io find God and with Him all the secrets of life; but it is to come into possession of the will and the power to live a contented and successful life through to the end. The Master’s example is of One who met life in all of its mul- Festive times call fo*1 the sparkling goodness of Coke So delicious with food • • • so easy to serve tiple demands, and He met it wiih "bare hands” so to speak; for He was poor and had a min­ imum of opportunity to prepare Himself for life’s demands. He met it with unwavering faith in God; He met it in the belief that Truth and Justice are stronger than falsehood and ruthless sel­ fishness; that reality must be followed even at the cost of blood and physical life, rather than ar­ tificially and some alternative to hardship that offers an easy or quick attainment of some desired goal. He said, “In the world you shall have tribulation (even fol­ lowing Him): but be of good cheer; I have overcome the world (John 16:33). Reader, have you answered the Master’s invitation, "Follow Me?” Tf you have answered His call wholeheartedly, then you can at­ test the truth of the things I have indicated as some of the meaning of ihe short text. You, like Mat­ thew, the publican, have found that all you; gave up for Christ hn* been a thousand times re­ paid, even in this life. And, in addition, you “have a hope that is steadfast and sure” concerning the future. You are both ready to live and ready to die. And to (hose who have not accepted Christ’s • blessed invitation there is no better time than NOW to accept it. Harmony n By MRS. RALPH V. MOORE 'SOTTIED UNDER AUTHORITY Of THE COCA-COIA COMPANY IY . WINSTON COCA-COLA BOTTLING COMPANY 1053, T H E . COCA-COLA COMPANY ’Coke" Is a registered trade-mark The Fannie Harmon Bible class met Friday evening at the home of Mrs. R. M. Hix with Mrs. Minor Hix, Mrs. R. A. Kimbell and Mrs. W. A. Jones co-hostesses. Mrs. Lee Jones, president, pre­ sided over the business session. It was decided to place flowers in the church Christmas in memory of Jule White • and then carry them to a shut-in. Mrs. Robert Kinder had the devotionals. Mrs. Lee Jones taught two chapters of Bible study on Jeremiah. Mrs. Cloude Burgess sang a special. There were ap­ proximately 20 members and one visitor present,' Mrs. “Bud” Payne. During the social hour the hostess served a salad course, cookies and coffee. Several families around here are having venison due to the fact that a number of- men have G o o d i>. to us and to all our friends You’ve probably heard about it—how the Ford Motor Company is getting into the farm equipment buameaa in ■ bigger way than ever before. Up to now, you see, Ford has designed, engineered and manufactured tractors—over two million of them all told. Now Ford, through the new Ford Tractor Division of the Ford Motor Company, assumes direct responsibility for both the Ford Tractor and the broad line of Dearborn Implements. What this mean* to you at farmers and lo us as Ford Tractor Dealers is that we can LOOK TO FORD — even more than in the past — for the best farm equipment that modem methods can produce at the lowest possible cost. As Ford Tractor Dealers, we have always tried to serve you well. Now, we are confident, we are going to be able to serve you even better—with a great tractor and with the latest and best in farm equipment to help make your work faster, easier and more profitable. Yes, this is good news to us—to our customers and all our other friends. BY THE WAY, HAVE YOU TRIED OUT THE ‘ NEW FORD TRACTOR GOLDEN JUBILEE MODELT Try out its new power, its advanced hydraulic system and tho easy way it handles. See how it does your own work on your own farm. Then price it! JUST NAME A CONVENIENT TIME FOR A DEMONSTRATION Davie Tractor & Implement Co. been deer hunting. Mr. and Mrs. “Bud” Payne and son of Troy spent several days with Mr. and Mrs. M. L. Davis. All the young people who have for the holiday. It looked like a re­ union at Church Sunday. CARD OF THANKS We wish to thank our many been away at college were home friends and neighbors for their kindness and rympathy shown to us during the death of our hus­ band and father. MRS. W. G. RAT­ LEDGE AND FAMILY. IT PAYS TO ADVERTISE fx-10A COLD 0 1 SCO M FOR' I X iq u JA . - 3 5 ^ P c r_ B o ttlo H eadline News FOR TRUCK BUYERS! NEW CHEVROLET TRUCKS FOR'54 NEW POWER IN THREE GREAT HIGH-COMPRESSION ENGINES • NEW COMFORTMASTER CAB. NEW RIDE CONTROL SEAT* , * • NEW AUTOMATIC TRANSMISSION* They’re the most powerful, finest performing, best-looking Advancc-Design trucks ever built! They're engineered to do your kind of hauling more efficiently and at lower cost. Come in, see these great new advances in the completely new 1954 Chevrolet-trucks. •Optional at extra cost. Truck Hydra-Matic transmission: RIdo Control Scat is standard on C.O.E. modols, available on all other cab modols as oxtra equlpmont. Roar corner windows in standard cab, optional at oxtra cost. NEW HEAVY-DUTY 3-SPEED TRANSMISSION* NEW,BIGGER LOAD SPACE NEW CHASSIS RUGGEDNESS • NEW ADVANCE-DESIGN STYLING MOST TRUSTWORTHY TRUCKS ON ANY JOB! P e n n in g to n C h e v r o le t C o ., Inc< PHONE 156 MOCKSVILLE, N. C. TELEV ISIO N PROGRAMS PHILCO TELEVISION —Sales and Service— --------— ' Hendricks • Merrell Furniture Company Salisbury St. - Mocksville R. C. A. WESTINGHOUSE —Sales and Service— DAVIE FURNITURE CO. TELE - KING TELEVISION -Sales and Service— ----------•---------- C. J. ANGELL APPLIANCE CO. MOCKSVILLE, N. C. R, F. D, No. 4 Salisbury Highway Mocksville J E W E L R Y AND EXPERT WATCH REPAIRING FOSTER’S WATCH SHOP 9:00-9:15 9:45lG:oo11:3012:0012:1512:30 12:451:302:002:30 3:00 3:30 4:00 4:30 5:00 5:155-306:00 0:156:30U:457:00 7:157:30 7:45 8:00 8:30 9:00 9:30 10:00 10:30 11:0011:1011:15 12:30 9:00 9-159:4510:0010:3011:0011:3012:00 12:1512:3012:451:302:002:303:00 3:30 4-00 4:305:00 0 5:15 5:30 0:15 6:306:45 7:00 W SJS W INSTON-SALEM CHANNEL 12 THURSDAY - 3—I’ll Buy That 3—Morning Show 3—Guiding Light 3—Arthur Godfrey 3—Strike It Rich 3—Valiant Lady 3—Love Of Life 3—Search For Tomorrow 3— Carolina Cookery 3—Gnrry Moore . •3—Betty Feeder Show 3—Art Llnkletter 3—Nancy Carter Show 12—Kate Smith 3— Bob Crosby 3—Arthur Smith 12—Atom Squad 3— 12—On Your Account 3—Children's Newsreel 12—Gabby Hayes 12—Howdy Doody 3—Story Painter 3—Lone Ranger 3—Visit With Santa 12—Roundup Time 12—News and Weather 12—Johnny Comas Presents 12—Curt L. Rogers Show 3—Jane Froman 3—Esso Reporter 3—Weather Report 3—Anybody's Guess 3—Spin To Win 3—Douglas Edwards 3—Hobby House 12—Camel News Caravan 3—Boston Blnckie 12—Groucho Marx 3—1 Lead Three Lives, 12—T-Men In Action 3—Lux Theatre v 12—Dragnet .3—Big Town 12—Ford Theatre 3—Meet Mr. McNutley 12—Martin Kano 3—Place The Face 12—News Final—sign off 3—News and Sports 1 3—Weather 3—Late Show 3—Sign-off ■n. A'. ii/Ja. •*** .10:00 •#. 10:30 W) • 10:45 •‘V 11:00 11:10 11:15 12:30 ir.j/iAft. 9:00 , .1%. 9:30 V ’ 10:0010:30 •2 11:00 • 11:30 R 12:00 .{■ i-oo i: is i; . 4:« j> 5:00 '5:30 i 6:30 "OS It? FRIDAY 3—Christopher Show 3—Morning Show 3—Guiding Light 3—Jack Parr Show 3— Wheel of Fortune 3—Man Around The House 3—Strike It Rich 3—Valiant Lady 3—Love of* Life 3—Search For Tomorrow 3—Carolina Cookery 3—Cary Moore 3—Double or Nothing 3—Art Linkletter 3—Big Payoff 12—Kate Smith 12—Kate Smith 3—Bob Crosby 3—Movie Matinee 12—Welcome Travelers 3— 12—On Your Account 3—Junior Rancho 12—Atom Squad 12—Gabby Hayes 3—Hopalong Cassidy 12—Howdy Doody 3—Football This Week 12—Roundup Time 3—Coke Time 3—Esso Reporter 3—Weatherman 12—News and weather 3—Anybody’s Guess 12—Johnny Comas Presents W BTV CH ARLOTTE CHANNEL 3 7:15 3—Do It Yourself ■7:30 3—Douglas Edwards 12—Eddie Fisher . 7:45 3—Perry Como12—Camel News Caravan 8:00 . 3—Mama12—Garroway At Large 8-30 3—Topper12—Life of Riley 9:00 3—Playhouse of Stars 9:30 Mirror Theatre12—American Inventory 12—Boston Blackie 3—National Theatre 12—Boxing 3—Pride of The Family 12—News Final (Sign off)3— News And Sports 3—Weather Report 3—Late Show 3—Sign off SATURDAY * 3—Mr. Wizard 3—Captain Video 3—Captain Midnight 3—Johnny Jupiter 3—Cisco Kid 3—Smiling Ed McConnell 3—Big Top 3—Game of Week Preview 3-^Football2—Pontiac Soreboard3—Judge For Yourself 3—To be announced.3—Ramar of the Jungle 12—Film Feature 3—-Fireside Theatre 12—'This is The Life 3—Burns and Allen 12—American Forum 3—Beat The Clock 12—Armchair Playhouse 8:00 3—Jackie Gleason 8:30 12—Amateur Hour.9:00 3—Foreign Intrigue 12—Film Feature 9:30 3—Pepsi Plnyhouse 12—Show of Shows 10:00 3—Ford Theatre 10:30 ?—Four Stnr Playhouse 12—Hit Parade 11:00 3—Weeks News In Review 12—News Final (Sign Off) 11:15 3—WrnsMlng 12:15 3—Medallion Theatre 12:45 3—Sign off SUNDAY 12:00 3—This Is The Life 12:30 3—Names The Same 1:00 3—Stu Erwin 1:30 3—Frontiers of Faith 2:00 3—Redskins Football Game 12—Professional Football 4:30 3—Adventure 12—Film Feature 5:00 3—Omnibus 12—Excursion 5:30 12—Youth Wants To Know 6:00 12—Frontiers of Faith 6:30 3—Mirror Theatre12—Kukla, Fran and Ollle 7:00 3—Ozzle and Harriet12—Wlnchell and Mahoney 7:30 3—Jack Benny 12—Mr. Peepers 8:00 3—12—Comedy Hour 9:00 3—Fred Waring 12—TV Playhouse 9:30 3—Man Behind The Badge 10:00 3—Who Said That 12—Letter To Loretta 10:30 3—What’s My Line * v 12—Man Against Crime 11:00 3—Sunday News Special 12—News Final Sfgn>off 11:15 3—Toast of The Town 12:15 3—Sign off General Electric -Sales and Service—• DANIEL Furniture & Electric Company AT OVERHEAD BRIDGE MOCKSVILLE, N. C. Laundry and Expert Dry Cleaning 6:30 7:00 7:30 Mocksville Laundry & Dry Cleaners DEPOT STREET Manufacturers of Ladies’s Pajamas ---------•---------- M O N L E IG H GARMENT CO. “ OUTFITTERS to MEN" TREXLER BROS,, Inc. SALISBURY, N. C. THURSDAY, DECEMBER 3, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE PAGE NINE Turkey Foot r Farmington Dr. L. R. Shaw, Mrs. Shaw and daughters visited T. T. Shaw and Mjss Duo Shaw Sunday. Mr. and Mrs. J. R. Smith and . son visited Mr. and Mrs. J. H. “ Brock and daughters Saturday night. Mr. and Mrs. R. C. Poster were dinner guests ot Mr. and Mrs. C. ' C. Trivette and family Thanks­ giving. Mr. and Mrs. James Stack and son of Beach Haven, N. J., Har- • r'ell Renegar and sons were dinn- ■ er guests of Mr. and Mrs. M. O, 'Renegar Friday. Mrs. John West of Advance, Rt. 1, Mr. and Mrs, W ill Fry, Mr. and M rs. David Frye, Mr. and Mrs. .J. F. Frye and son of Winston- Salem were dinner .guests of Mr. and Mrs. Foy Reavis and children 'Thanksgiving. ; Mr. and Mrs. Ralph Adams and daughter of Alabama, Mr. and Mrs. White Mustryan and daugh­ ter of Vermont, Va., Miss Jo Ann <Grose of ASTC, Boone, visited M r. and Mrs. R. C. Grose last -week. Mr. and Mrs. B. C. Brock, Sr., had as Sunday dinner guests: the Rev. and Mrs. M. T. Hipps of Thomasville; Rev. and Mrs. W. Q. Grigg of Mocksville; and Rev. G. C. Graham. Mr. and Mrs. B. G. O’Brien of Pembroke, were Sunday" guests of Mr. ani3 Mrs. Gilm er Ellis. Miss Nancy Collins of Wash­ ington, D. C., Misses Pat and Helen Collins of Fletcher, spent the Thanksgiving holidays with their parents, Mr. and Mrs. J. L. Coll­ ins. Dr. and Mrs. David Graham of Tryon were week end guests of Rev. and Mrs. G. C. Graham. College students home for the holidays were: Harold Seats and Bayne Miller, State; W illiam Lau­ rie Brock, Don and Betty Busick, Guilford; Miss Mary Elizabeth Brock, UNC. Sunday guests of Mr. and Mrs j W. H. Seats were: Mr. and Mrs. Hubert Slater of Winston-Salem; Mr. and Mrs. Henry Douthit and children, Mr. and Mrs. B illy Seati and daughter, Rebecca, Mr. ant Mrs. June Pilcher, Mrs. Nan Me Elbaville Miss K ay High of Columbia, S. C., has been the guest of Mr. and Mrs. R. C. Ratledge the past week. Miss Betty Jean Tucker, daugh­ ter of Mrs. Nettie Tucker and Jim m y James of Clemmons were married Monday, Nov. 23 at High Point Mr. and Mrs. Frank Bailey of Winston-Salem were visitors at Sunday School Sunday. Messrs Russell and H ill of Har- Headquarters for ic H w iN N B i c y c l e s Schwinn Panther . M $82.95 Bride, Misses Virginia and Rachel Boger, Louise Seats and B ill Perryman, Ira Seats and Bayne Miller. I Miss Belle Smith spent the! week end with her parents in Rae- j ford. Mrs. W illiam Scholtes of W in­ ston - Salem, and Edgar Scholtes of Ft. Jackson, Richard Brock of Fort Bragg, Mrs. M. B. Brock and Miss Margaret Brock of Greensboro were visiting rela-j tlves here over the week end. | Mr. and Mrs. James Sherrill and two daughters visited Mrs. Robert White, Mrs. Sherrill’s sis-: ter, during the Thanksgiving hol­ idays. J. L . Collins left for Dallas, Texas, Tuesday morning. ker’s Island visited Mr. and Mrs. F, P. Tucker last week. Mr. and Mrs. J. O. Markland and daughter, Anne, of Norfolk, Va., spent the holidays with rela­ tives in this community. Mrs. F. P. Tucker and Miss Connie Faye shopped in Lexing­ ton last week. Mr. and Mrs. R. R. Fulk of Pinn­ acle visited Mir. and Mrs. Kenn­ eth Hoots last Sunday. Mrs. J. - G. Zimmerman1 is vis­ iting her daughter, Mrs, Ernest Whalen in New Bern. Mr. and Mrs. T. K . Hall and children of Kernersville spent a few days last week with Mrs. Charles W. Hall. Mr. and Mrs. Sam Hege enter­ tained at a 'Thanksgiving dinner honoring Mr. and Mrs. Charles Garwood of Winston-Salem, Mr. and Mrs. J. O. Markland and M iss'Anne Markland of Norfolk, Va., Mr. and Mrs. Buck Edwards and baby of Greensboro, Mrs. Johnny Dunn and Mitzi of W in­ ston-Salem and Mr. and Mrs. Pete Markland of Elbaville. Mr. and Mrs. Avery Hartman and children of Winston-Salem, and George Hartman of Redland were Thanksgiving dinner guests of Mrs. Clara Hartman. Mr. and Mrs. Chick Hartman of Redland visited Mrs. Clara Hartman,_ Sunday night. Dr. Raymond E. Connell, pas­ tor of Courtney Bap:ist Church, is seriously iil in a Waynesville hospital. He was stricken early Friday while dear hunting there. He is also a teacher in Courtney High School. Mrs. Emma Ratledge left Sun­ day with her daughter, Mrs. Russell Nifong of Winston-Salem to visit her several days. Miss Viola Lowery of Kannap­ olis spent Sunday with Mrs. G. A. Laymon. Mr. and Mrs. Douglas Ratledge and daughter of New Bern, Mr. and Mrs. Lawrence Taylor and children, Mr. and Mrs. Burton Neal and children of Walnut Cove and Mr. and Mrs. V{illiam Rat­ ledge were guests of Mr. and Mrs. A. C. Ratledge Sunday. Thanksgiving dinner guests of Mr. and Mrs. Joe Shelton were' Mrs. E. J. Shelton, Dr. and M rs.1 L. R. Shelton and children, Bonnie and Kenny of Winston-1 Salem, Miss Phosa McClannon and Miss Madeline Boger of Mocks­ ville. Thursday dinner gues‘s of Mr. and Mrs. L. S. Shelton were:. Mrs. Manus Welborn and Paul of W in­ ston-Salem, Wayne Welborn and G. T. Baity. Advance Adage By B A R B A R A PO TTS and M ILD R ED N AN CE With Thanksgiving holidays be­ hind us now and Christmas not far away, the activities begin to in­ crease. Returning home for the holi­ days were: Mr. Frank Hardin to Canton; and Miss Mary Rose Hall to Kannapolis. Our- first ball game was play­ ed Tuesday night, Dec. 1, at Courtney. There was also a pep rally held in the gymn Tuesday morning at 10:30. The seniors are planning a chapel program to be given some­ time in December. They are: “Call Hector’ 'and "Three Strikes and Out.” Characters include: Connie Foster, Kenny Burton, Peggy Cornatzer, Henry Hendrix, Glenn Potts, Gelene Jolly and Gilbert Holder. Visiting Mr. and Mrs. ,George Baity during the Thanksgiving holidays were Mr. and Mrs. Loyd Holcomb, W. S. Low ery and son, Wilburn of Charlotte, Mr. and Mrs. Manus Welborn and family of Winston-Salem and G. T. Baity. Mr. and Mrs. Leon Baity and son, Ronnie, spent Thursday with her parents, Mr. and Mrs. Floyd Joyner, near Liberty. The Sunday evening prayer service was held by W. S. Phelps He used “Sin and Temptation” for. a subject. ^ • David Crater had the misfor­ tune of falling and breaking his arm one day last week. Little Johnnie Myers is slowr ly improving. Mr. and Mrs. Kerm it Beau­ champ of Lexington visited Mrs. J. W. Beauchomp Saturday. Mr. and Mrs. Joe White of Win- ston-Saelm visited Mrs. O. F. Jones last Thursday. Mr. and Mrs. X. A. Hilton and children of Clemmons visited Mr. and Mrs. Roger Mock Sunday af­ ternoon. Mr. and Mrs. Alden Myers and little daughter of Winston-Salem spent, Sunday with Mr. and Mrs.. E. A. M yers.. Mrs. Jack Phelps and children of Winston-Salem spent Sunday with Mrs. Roy Carter. SU PPER AND BA ZA A R The Elbaville Church w ill sponsor a pie suppe rand bazaar on Saturday, Dec. 5, in the Ad­ vance community bulding. Serv­ ing w ill begin at 5 p.m. Proceeds will go into the church building fund. • Glistens with chroma lenders,tank, fitting % • Has headlight, spring fork, front brake, farrier Wntch your boy light up when ho seen this finally, two-tone model. Fully equipped nnd gunrnntced as long ns you own It. Girl's Spitfire Murray Fire Truck Schwinn Skipper Buy Schwinn depen­dability nt a Biivinc, ndd accessories Inter. Kick stand. Cimin guard. BrUlinnt red. well decorated, with bell, ladders, handrails. BnlUbearintr wheels end drive mechanism. Best first two-wheelor (with side wheel*) for children 3 to C. Has cortster brake, other bie bll'e features. $48.95 $20.95 $44.95 SELECT A CHRISTMAS BIKE NOW-PUT !T ON IAY-A WAY children • Colorful plastic trilling bird is our "Merry Christ* mat" gift to every child accom panied by an adult. Visit our gay House of Santa Claus toon fo r your FREE WARBLER. G IF T ID E A S Complete line of Electric Trains Miniature Pool Table complete with cues and balls $8.95 Dolls of all kinds Deluxe Doll House $4.98 B. F. Goodrich TRACTION TWINS i W inter Traction Tire for country driving, un­ cleared roads, mud. You get ns much as 25% more pulling power in deep snow. 2.B FG UFE-SAVER. Tubelest Tire 011 icy roads, packed snow, rainy streets—stops up to 30% quicker. Thtfusnnds of tiny grip-bloclss grip in­ stead of slip. gk>iSi9iai9iSiSi9>3)3iSl3i3i3)3i3iaiSi9l3l3iSi3i3i3i3i3i3)li3i3)3iaiai»l3i>i3l3)SiSl3l3l>l3l9lM Complete line of KITCHEN APPLIANCES « K % I I *Xtc«ie>eteic>eif.isteicie>e«‘e<ei3teteit;tc>eteieieteieiet(isteie«tete«K;tc!c<e‘eieteteietciet3<e • Mixmasters • F ri Wells • Irons O Waffle Irons Toasters Percolators Mocksville Home & Auto Supply C. R. CREN SH AW , Owner F. G o o d r ic h FIRST IM RUBBER B I t ’s th e B est ga solin e y o u ’v e ever been a ble to use in y o u r ca r! GIVES ANY ENGINE th e u tm ost w ork in g h orsepow er under to d a y ’s a ll-rou n d d rivin g con dition s N E W w m P O W E R E S S O E X T R A Total working horsepower for the highest-compression eivrsl For many late model high-compression cars “Total Power” Esso Extra : makes it possible for tho first time lo enjoy full per­ formance without a trace of knock or ping. I Total working horsepower for many, new cars wj^ro total performance is now kept “under wraps” by re­ tarding the spark to avoid knocking. These cars may be set to fully efficient tim­ ing, getting more horse­ power, better gas mileage, Total working horsepower wherever “cold engine stall­ ing" is a critical problem on cool, moist days, its special additive protects against stalling caused by carbure-’ tor icing, permits maximum nossiblepower-flow from the time you start your engine. ESSO STANDARD OIL COMPANY Esso Total working horsepower can benefit present users of “regular” gasoline in short- trip, around-town driving. By switching to new "Total Power" Esso Extra, they can get better mileage this . winter,.. better alf-around performance, too. The Sign of “Happy Motoring* Ccpr. 1553, SjjoJbc. New “TOTAL POWER” ESSO EXTRA is a blend of hydro-carbon power components especially engineered to meet the total power and fmti-knock requirements ■' of even the highest-compression new engines.For mil­ lions of older cars it means better working horsepower and better total engine performance. It is not only the finest gasoline in Esso history . , . but the very best gasoline you can buy! TOTAL POWER means just what it says. It means, to begin with, a great advance in sheer high-compres- sion POWER under the toughest driving conditions. It means POWER to start fast in any weather... POWER for fast warm-up . , , POWER to kill off knocks and pings . . . POWER to resist cool weather , stalling. . . POWER to take steep hills in stride, ,'fPOWER to pick up swiftly from a standstill. It means that in the total of the jobs your engine is called on to do, you can expect the maximum that can be obtained from any gasoline that you can buy. The inevitable result is the kind of smooth performance and long mileage you've - aljvays wanted. For the very newest in “Happy Motoring” try new “TOTAL POWER" ESSO EXTRA today. You will find no other gasoline gives you more in extra performance under today’s all-round driving conditions, E MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 3,195? Mr. nnd Mrs. Bill Hendrix and son, Sieve, were guests of Mr. and Mrs. R. A. Fairchild in North Wlkesboro Sunday. Mesdames J. A. Fos'er and Rob­ ert Conrad spent Sunday, and Monday with Mr. and Mrs. Ray ■Howard in Clemmons. Mrs. W illiam Beeding of Corn­ atzer was the week end guest of Mrs. W. R. Beeding. Mrs. R. E. Williams is confin­ ed to her home by illness. Mrs. J. M. Smith of Mocks­ ville Was luncheon guest of Mrs. J. H. Foster, Sunday. Mr. and Mrs. George Smith and Mrs. Grant Smith and daughters visited Mesdames W. L. Hanes and J. T. Angell Sundf” afternoon. • Mrs. F. A. Naylor was honored Sunday at a dinner given by her daughters, Mrs. Earl Caudill, and Mr. Caudill at their home in North Wilkesboro, on her 80th birthday anniversary. Guests in­ cluded: Mr. and Mrs. J. M. Groce and Mr. and Mrs. Harry Sheek of Sm ith Grove; Mrs. T. H. Cash of Winston-Salem; and Mr. and Mrs. F . A. N aylor,'Jr. ,and Mrs. De- W itt Hhoades of Kernersville; Mr. and Mrs. Wake Watts and daugh­ ter, Jan, of Wilkesboro. Mr. and Mrs. Edw,v Williams and son, Keth, of Greenville, S. C., were week end guests of Mr. and Mrs. R. E. Williams. The W. S. C. S. of Smith Grove Methodist church w ill conduct a study course al the home of Mrs. J.' H. Foster Thursday afternoon at 2 o’clock. Mesdame" J. M. Groce and J. T. Angell spent Monday afternoon with Mesdames G. C. Hendrix and Bessie Penry. Mr. and Wtrs. Joe Spry of Mocks­ ville were dinner guests of Mr, and Mrs. W. G. Spry Sunday evening. The Ladies Bible , Class met Saturday afternoon with Mrs. J. T. Anegll, the president. Mrs. J. M. Groce had charge of the de­ votional period. The Bible study from the book of Genesis was led by Mrs. Angell. At the business session plans were made for the annual Christmas party in the home of Mrs. J. M. Groce, Dec. 18, at 7 o’clock. Refreshments were served to eight members. Mr. and Mrs. Raymond Mark­ land and children spent Sunday in Advance, the guests of Mr. and Mrs. C. M. Markland. Mrs. Grant Smith and daugh­ ters, Rosalee and Kathy, spent Thanksgiving day here with Mrs. J. T. Angell. SU PPER A T C EN TER The W SCS of Center Metho­ dist Church w ill sponsor a supp­ er on Saturday, Dec. 5, beginning at 5 o’clock in the communty building. The menu w ill consist of hamburgers, vegetables, sal­ ad and desr.ert. Home made cakes w ill also be sold. Proceeds go to the church building fund. V/il .ir " Hill and Otis Russell of M crehiid Ci'y, spent Thursday nnd Friday with Seabon Cornat- zef. V/enlr md guest" of Mr. and Mrs. C. W. WM1 were R. B. Sheek and family nnd Donald White and fam­ ily of W'nsfcnn-Salem: R. P. Bo­ ger and family of Mocksville; Mr. and Mrs. Bi'l Wall of Clemmons and Mr. and Mrs. Fordie Beauch­ amp of Redland. Wade Cornatzer and family of Greensboro spent. Sunday with, ?firs. II. P. Cornatzer. C. E. Chapman and Joann of South Carolina were Thanksgiv­ ing guests 'of Mr. and Mrs. G. Frank Mock. : George F. Cornatzer and daugh-' ter, Peggy, visi'ed Mr. and M rs.! Floyd Hellard and Mrs. Am anda. Bowers, near Hanes, Sunday. j Mr. and Mrs. Clint Cornatzer ' spent Saturday with Mr. and Mrs. O. R. Burchette in Hamptonville. - Mrs. J. W. Keeton visited in ' Salisbury during the week end. Mr. and Mrs. J. A. Newman spent Sunday with Mrs. Ellen Newman in Winston-Salem. Mr. and M ri. Luther Scott and children of Winston-Salem; Mr. and. Mrs. Wade Baity and daugh­ ter of Lewisville and Mr. and Mrs. Hubert Everidge and Mrs.. Flora Baity of Clemmons were dinner guests of Mr. and Mrs. C. N.' Baity, Thanksgiving Day. “L E T GOD B E T R U E ’ By PA U L S IK ES The erceds written by men must contain exactly what the •vnrd of God says, less than the ^iib’.e, oi- more than the Bible. If t^eso creeds just contain the then why have them? Is rvt, the Bib’e sufficient? If on the nthfer han they contain more or 1/ ': ■' than the Bible then they should be rejected as mere pro- drrtions of men. Do creeds of men contain any­ thing that help men and women to bo better servants in the king­ dom of our Lord? If this queslon is answered in the affirmative then we are admitting that tho Bible is not to be relied -upon as a complete guide for men and women today. We slander the Lord when we go to the creeds of men. We imply that God was not wise enough to- make his will known to us and that it takes man, the creature, to simplify the w ill of God. Rather than simpli­ fying the matter man generally mixes up the issue so much that would be seekers after God fail to be taught the truth. Let us cen'-.e trying to help God and start helping ourselves by accepting and obeying his word. The creeds of men are constantly being re­ vised and changed to suit the people, age or country. God changes not. Let us plead for the sufficiency of the scriptures. "All scripture is given by inspirations of God, and is profitable for doctrine for re­ proof, for correction, for instruct­ ion in righteousness; that the man of God may be perfert, thorough­ ly furnished unto all good works." (II Tim. 3:16, 17). Believing this verse would cause us to do away with the creeds of men. Listen to what Peter said “According as his divine power hath granted unto us all things that pertain un­ to life and godliness .. . ’’ (II Pet. 1:3). 'The words of Jesus w ill judge us in the last day. No one w ill be judged by the creeds of men, so why have them? “But though We, or an angel from heaven, preach any other gospel unto you then that which we have preached upto you, let him be accursed.” (Gal. 1:8). If the creed is like God’s word, we do not need it, if it is not like God’s word we w ill be cursed if we use it. Creeds distinguish peo- Advance Egt. and Mrs. John L. M ark­ land and daughter, Sandra Lee, of Arlington, Va., spent the Thanksgiving holidays with his parents, Mr. and Mrs. L. E. Mark­ land. Thanksgving dinner guests of Mr. and Mrs. G. E. Markland were Mr. and Mrs. Taylor How­ ard, Mrs. Milton Carter, Charles Markland, Mr. and Mrs. Frank Markland and Sgt. and Mrs. John L. Markland. Mr .and Mrs. Allen Lambert of Winston-Salem were Sunday af­ ternoon vsitors of Mr. and Mrs. G. E. Markland. Mr .and Mrs. B. R. Bailey’s Thanksgiving dinner guests were Mrs. Richard Lindsey of Mon­ tana; Mesdames Robert Bray, E. M. Stockard, W. K . Ferrell and le as to what they believe. This fact proves that they are wrong because all are to “ . . . speak the same thing, and there be no divisions among you ...” (I Cor. 1:10.) Adv. JER ICH O CH URCH O F CH RIST Mr. and Mrs. A. J. Marshburn, Jr., of Greensboro; and Mrs. A. J. Marshburn and Misses Lena' and Ruth Marshburn of Guilford College. W. A. Hendrix is sick at his home here. Miss Janie Townsen of Florida, visited her grandparents, Mr. and Mrs. W. A. Hendrix, Thanksgiv­ ing. Miss Mona Ellis Foster and Miss Mildred Spry shopped in Salis­ bury Friday. Mrs. Walter Cornatzer enter­ tained at a turkey dinner Thanks­ giving day. Attending the dinner were Dub Hendrix and Mrs. Glenn Potts. , Visiting Mrs. W. A. Hendrix Sunday were Mrs. Ellis Foster of Winston - Salem; Mr; and Mrs. Glenn Hendrix of Lexington; and Mr. and Mrs. Clarence Peeler of Salisbury. Miss Ruby Potts of Boone spent the —Thanksgiving holidays with her parents, Mr. and Mrs. Gene Potts. Mrs. Grace Sprye’s Sunday guests were: Miss Mona Ellis Fos­ ter, Mrs. Junior Sprye, Mjre. James Sprye, Mrs. Gene Potts and Mr. and Mrs. Garland Sprye. Daniel Furniture Co. w ants to g iv e y o u z m W f i h i s *72.95 C H A T H A M j U M M j B L A N K E T WITH EVERY MOM! DAD! A L L T H E K ID D IES ! Yo u’ll all love Santa’s N EW TO YTO W N . . . Our full-of-fun department where Santa makes Christm as promises . . . and keeps them, with our huge stock of toys and dolls. A ll Types $1.75 up DOLLS Sft IX«a %ftI ft1 *a Tricyles $8.95 and up B LA C K B O A R D S 3 Bonnie Braids Doll, $6.75 ft*A 1ft ! S a *a <aft %ftftft % Red Coaster W AGONS $1.85 ■ $9.25 I ftftxft«ftftftft £kaakft %/s $ft TO O L S ET S $3.95 and up \ W M / KINGSDOWN SLEEP V cTo o o ^ j SET '— Frcm n ow until Santa's left something here for you! A beautiful $12.95 Chatham Purrey Blanket Is yours , at NO EXTRA COST with every KINGSDOWN Sleep Set—specially Christmas wrapped—the most practical gift you could give or receive! This amazing offer Is good only 'til Christmas and stocks are limited— so H-U-R-R-Y! Come in soon and select your KINGSDOWN for the REST of your life and the blanket Is yours FREE as our gift to youl sdown gives you— Several Sizes Just the thing for that boy or girl 95c to $3.95 A ll Types CH RISTM A S T R E E LIG H T S $1.25 to $6.00 C H R ISTM A S T R E E H O LD ER S $1.25 to $2.25 wetetctctctcwtetcwtstetetztetetstststetcwti Castelli Pedal-Type TRACTORS $18.95 leistststgtefcteisigtewieie^tetaieteigiffieic^terciGss^te^stgie^ts^igigig'.gisieisig'sisigigieiesgigigtgigieigietgigigii'ieigiejgisisigtgigigteigtstgi&sigtgigtsipgijfgieia Metal D O LL B ED S $8.95 ft S.fla«a DRUM SETS $5.95 Several Sizes of ER EC T O R SET S $7.95 to $12.95 tgictsisieigssieigigtgictgieigieisteiaigieiassigieisigK-^ieigtsig^^istgsgietgiaisisisisSig^igtgigigig’eigisigJciatefeisieigisigieisigieieisieigteieigieigigigigisfeigigigieis® Large assortment of. all types of Toys . Ksis:£t9)3)9t»!^3i9ts;st3g9i3i3;3t9i3i3i3t3isi%si%si3iicie>e!s<e!e>etsieic>e«s‘e>e>e>e>a!e>s>s>s<cietsieteieiele!etg(i;!etgie!eistetsieteteis!gie«teiete%!sicie!2tstgietstetg M U SIC A L IN STR U M EN T TO Y S 32 piece CHINA SETS $3.95 to $8.25 a §n rtftft Cannon TOWEL SETS 95c to $4.50 Betty Crocker ts General Mills All-Purpose FOOD M IX ER , $35.49 EACH UNIT—TERMS I , Christmas Candies and Nuts FREE CHATHAM BLANKET IS W AITING FOR YOU Pure Sugar S T IC K CAN DY....2 lb box, 55c C H O C O LA TE D R O P S ........................25c lb. CO CO N U T BON B O N S .........35c & 45c lb. G R A N p E S L IC E S .................................20c lb. NO B U TTO N S — Comjort eyelet does away with lumpy tujts and buttons! HOUR-GLASS COILS —Set/ - equa I h i tig I a d ju s ts to to e individual! REIN FO RCED EDGE — Specially designed coils Jo prevent sagging— adds years oj comjort/ Home Made K IT C H EN C A N D Y .........35c lb. B R A Z IL CR EA M N U T S .....................40c lb. P E C A N S .......................................‘............35c lb. EN G LISH W A L N U T S ........................40c lb. HARD CH RISTM A S M IX ................25c lb. Daniel Furniture & Electric Co. MARTIN BROS. Phone 99----------“Your Complete Shopping Center Under One Roof”'---------Mocksville, N. C. Phone 198 Mocksville, N. C. THURSDAY, DECEMBER 3, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE PAGE ELEVEN C L A S S IF IE D A D R A T E S : T W O C E N T S P E R W O R D P E R IN ­ S E R T IO N . M IN IM U M C H A R G E 5 0 c . C A S H W IT H O R D E R . C A R D O F T H A N K S $ 1 .0 0 , C A S H W IT H O R D E R . FOR SALE—Good used double barrel! shotguns, $35 to $150. Pnrkcr, Lcfcvcr, j Ithncn, L. C. Smith, French, English nnd Gorman mnkcs. John E. Hnrpo, Sr., 2024 Maplewood Avc., Wlnston- Snlem, N. C. Phone 3-6209. 12 3 ltn j LOST—one snxnphonc, E-Flnt Alto. Hol­ ton make, cilver, factory serial num­ ber 11275. In black carrying case bear­ ing words “Catawba College. Salis­ bury. N, C.’* Accessories Included. Lett In ear while receiving a ride from Ca­ tawba College to Davie Crossroads. No­ tify David E. Milholcn at No. 4 Circle Drive, Cooleemee, or Catawba College, Salisbury, N. C. 12 3 2tp % W A N T FOE RENT—Two 4-room duplex apart­ments. Modern conveniences or will rent at a whole. Very reasonable rent. See Mrs. W. J. McDonald, Kt. 2, mocks- , ville, or The Enterprise. 11 2G tfn FOB SALE—1948 Packard convertible, like new; 1047 Frazer 4-door Sedan with rndio and heater; three-quarter ton International pickup. All in good condition.: See Tom Ellis, Advance, N. C. __________________ IMMEDIATE OPENING Woman with car, age 25-54, who needs to earn above average Income. Ambition, Rood personality and ap­pearance necessary. Free training, no Investment. For personal interview write P. o. BOX 4B7, SPENCER, N. C. 11 19 Stn Mr. and Mrs. David Swaim moved into their new home near Ephesus Saturday. Mrs. Floyd Frye is a patient at Baptist Hospital in Winston-Sa­ lem. Her condition is satisfactory. Mr. and Mrs. Bean of Fork vis­ ited Mrs. Travis Carter recent­ ly. Mrs. Roland Hanelino of Mocks­ ville spent a few days with Mr. and Mrs. Worth Potts.. T h e Cornatzer Community Circle w ill hold its annual Christ­ mas . party Friday night at the regular meetng place. Mrs. J. C. Barney has been sick with pleurisy, but is able to be out again. FOR WELL BORING AND CASING FURNISHED, *2.75 PER FOOT. ALL WORK GUARANTEED, 5 YEARS EX­PERIENCE. CALL COLLECT, C. E. SETZEtl & SON, CATAWBA, N. C„ PHQNE 2921 OR 1927. 10 29 8tp WANTED — Have y<r*r prescriptions filled at HALL DHj G COMPANY. Phone 141, Mocksville. tfn Jim Foster is sick at his home here. His friends wish for him a speedy recovery. A. L. Ellis is still not able to be out. Mrs. Ralph Po'ts spent Thanks­ giving in Salisbury with rela­ tives. Mrs. Herbert Barney a n d daughter, Mrs. George Boger, were Sunday dinner guests of Mrs. Alvin Dyson at Ephesus. Mr. and Mrs. Adam Baker and Mrs. Penry of Salisbury visited Mr and Mrs. Edward Boger a while .Saturday afternoon. Ernest Howard visited his mother, Mrs. Lula Howard, Sun­ day. Mrs. Howard continues sick at her home in Winston-Salem. Little Dennis McCulloh will undergo a tonsil operation this week at Rowan Memorial Hos­ pital, Salisbury. IT PAYS TO ADVERTISE HAVE YOU THE ARTHRITISMISERY? h e r e 's w o n d e r f u l n e w s ! Hospital tests prove Musterole gives high­speed long-lasting relief from pains of arthritis misery. Also greater ease in moving. Highly medicated. Concentrated. You can f e e l it work to bring fast relief! MUSTEROLE Va PRICE SALE C. .T. AN GELL, A PPLIA N C E COM PANY SA LKS & SER V IC E Phone 259-J KILL THOSE IIOGS N O W The “North Pole” tem­ perature in our freezing rooms is JU ST RIG H T for Hog Killing time. Bring us that meat—we w ill cut and process it to your order. Don’t let the warm weather keep you from doing it NOW. Our entire forca is always ready a n d happy to serve you, our good customers. DAVIE FREEZER LOCKER Phone 340 To Rdieve Misery of P H &666 LIQUID ON TABLETS*SAME FAST RCUCF GENERAL ELECTRICAL CONTRACTING and Electrical Service. N. C. Licensed Electrician and Contractor. REA CER­TIFIED CONTRACTOR AND DEAL­ER. HODWELL ELECTRIC COM­PANY, Mocksville, N. C. tin FOR SALE—1949 Lincoln Cosmopoli­tan, four door sedan, with low mileage. Excellent .tires. Clean In­side and out. See Mrs. J. C. San­ford. 11 19 3ta EXECUTRIX NOTICENotice Is hereby given that Mary Lelia Hopkins has this day qualified as exec­utrix of the Last Will and Testament of Alice Martin Hopkins, deceased, late of the County of Davie ’and State of North Carolina. AU persons having claims against said estate will present tem. duly verified, to Mary Leila Hop­kins, at her home on Mocksville, Route 3, on or before the 26th day of Novem­ber, 1954, or this notice will be pleaded ln bar of their recovery. All persons In­debted to said estate will please make immediate settlement. 11 26 OtpThis the 19th day of November, 1953. MARY LELIA HOPKINS, executrix of ALICE MARTIN HOPKINS, deceased. NOTICE OF ADMINISTRATIONNotice Is hereby given that the under­signed, J. K. Meroney and Helen M. McBee, have this day qualified as ad­ministrators of Emma K. Meroney, de­ceased. All persons holding claims against the said estate will present them to J. K. Meroney, 437 Salisbury Street, Mocks­ville, N. C., duly verified, on or before the 2nd day of November, 1954, or this notice will be pleaded ln bar of their, recovery. All persons indebted to said estate will please make immediate settle­ment. 11 5 Ot This 2nd day of November, 1953. t J, K. MERONEY HELEN M. McBEE Administrators of the estate of Emma K. Meroney.Robert S. McNeill, Attorney. EXECUTOR'S NOTICE Notice Is hereby given that Agnes S. Sanford and John S. Sanford have this day quallfiod as executors of the Last Will and Testament of John C. Sunford, deceased, late of the County . of Davie and State of North Carolina. AU persons having claims against said estate will present them, duly verified, to Agnes S. Sanford, at her home on South Main Street, Mocksville, N. C., on or before the 2nd day of November, 1054, or this notice will be pleaded in bar of their recovery. A11 persons In­debted to said estate will please make immediate settlement. 11 5 OtThis 2nd day of November, 1953. AGNES S, SANFORD JOHN S. SANFORD Executors of John C. Sanford, deceased Robert S. McNeill, Attorney. j NOTICE OP ADMINISTRATION !Notice is herby given that the under­signed, J. K. Meroney and Helen M. Mc- Bee, have this day qualified as admin­istrators c.t.a. of C. -F... Meroney, Sr., de­ceased. All persons holding claims against the said estate will present them to J. K. Meroney, 437 Salisbury Street, Mocksville, N. C., duly verified, on or before the 2nd day of November, 1954, or this notice will be pleaded in bar of their recovery. All! persons indebted to said estate will please make immed­iate settlement. 11 5 Ct This 2nd day of November, 1953.J. K. MERONEY HELEN M. McBEE Administrators c.t.a. of the estate of C. F. Meroney. Sr.Robert S. McNeill, Attorney. NOW . . . you can g»' TWO (regular $2.95 each) VENIDA "Hang Over" Hang.n, designed la conform lo your everyday drening habits—coot first Ihen trousers— for the price of ONE . . . PLUS a BONUS GIFT of o sturdy pair 6f canvas ia!e, terry cloth tlipperil These beautiful hangers are made of durable cellulose plastic with an attractive walnut finish—an unusual life­ time convenience for men and womenl Individually pack­ aged In a colorful picture box—an Ideal glftl VENIDA MAKERS OF FAMOUS VENIDA HAIR NETS Vtnlda Product! 119 W«st 40th St.. N#w York 18, N. Y. “ Enclose! I* my th ick or mon*y ord»r tor $2.93. Stnd m t 2 V*nJdo "Hang O vtr" Hangers PIUS your Sptclol Bonus Gift of 1 Pair of Tarry Cloth Sllpp«r». Chick Stlppir Sis* O (Smell) Q (Mtdium) Q (Lorgt) NAME___________________________________________ _____________ ___________________ ADDRESS_____________________________________________________________ •__________ cinL.___________________JONt WHEELS ALIGNED By the BEAR System For Safe Driving R O B IE N ASH 1819 S. Main St. Plione G50 | SALIS1JURY, N. C. Electrical Gifts.... Of Course! Bring your cleaning and Pressing to us. We appreciate your business. WADE’S D R Y C LEA N IN G DEPOT STREET (Former Burnette Cleaners Building) See Your Electric Appliance Dealer DUK<Ep P O W E R C O M P A N Y , b u r n t (ib to & n a d . . . . TAYLOR MATTRES­ SES are so soft and com­ fortable! Every bed should have one of these QUALITY MATTRESSES. T h e TAYLOR MAT­ TRESS COMPANY in­ vites you to come in and see the most popular MATTRESS . . . TAYLOR MATTRESSES. When you want the best for less in sleeping comfort buy a TAYLOR MATTRESS. See your local FURNITURE dealer for information on TAYLOR MATTRESSES.• « Taylor Mattress Co. SA LISB U R Y . N. C. ROWAN PRINTING CO. Phone 532 - Salisbury, N. C. One of the largest printing and office supply hou**« in the Carolina*. • Printing • Lithographing • Typewriters ,• Complete Office Supplies SH O A F C O A L AND SAND CO M PAN Y Depot St. Phone 194 • VMM pniscniPTioK t* K Vf&itderfui Hefp idfe Covfth For coughs and acute bronchitis due to .colds you can now get Creontulsion specially prepared for Children in anew pink, and blue package and be sure:(1) Your child will like it,(2) It contains oniy safe, proven ingredients. ,(3) It contains no narcotics to dis­ turb nature’s processes.(4) It wilt aid nature to soothe and heal raw, tender, inflamed throat and- bronchial membranes, thus relieving the cough and promoting rest and sleep. Ask for Crcomulsion for Chil­ dren in the pink and blue package. CREOMUCSION FOR CHILDREN • Coughs, Chest Colds, Acute Bronchi!!*-. Wilkins Drue Co. I’hone K1 TO RELIEVE *DISCOMICnVSor common jy . AND COUGHS DUE TO COLDS iNiiCR A U TO M O BILE S A F ET Y Glass & Mirrors Installed —All Models— R O BIE N ASH 1819 S. Main St. — Phone 650 Salisbury, N. C. SHOAF C O A L, SAN D & STO N E — Prempt Delivery — Phone 194 (Jse An Enterprise Want Ad For Dogs ond livestock SEVERE MANGE, ITCH, FUNGI, BARE SPOTS AND MOIST ECZE­ MA (puffed, noitt ears and feet). Ear soreness, ear mite*, pun pim­ ple* and ocher «lcin irritations. Pro­ motes healing and hair growth oe YOUR MONEY BACK. W ILK IN S D RU G CO.PHONE 31 MOCKSVILLE V V .V .W .V .V .V .V .V .V .W .% W .V V A V / ^ A \ \ V V iV V V V W I CUSTOM BUILT £ Venetian Blinds - Aluminum Frame Screens - Aluminum S Awnings - Ornamental Iron 5 Salisbury Venetian Blind Manufacturing Co. j Statesville Road Phone 4319 Salisbury, N. W A V . V . W . W . ' . W . W W . W W A W M l V I W .V .V .'.V .V /.V .V .V . AulfMrized Cadillac ■ Studebaker Service Performed by Factory-Trained Mechanics , 't t J E F - M J M U E .|/|gMECWNG ymmiVSTMG ViikmuftMG Baked EnamelAUTO PAINTING AU TypeBODY WORK Drive Iri Soon For That Fall and Winter Check-Up 24-Hour Wrecker Service Day Phone 14 — Night Phone 720 ® Hedrick Auto Co., Inc. Your Cadillac and Studebaker Dealer PH O N E 14 120-122 N. Church St. Salisbury, N. C. \ " .V .W .% W .V W .- .V /.V .W /^ A , .W .V A V .V W A , W A V W D I R E C T O R Y o f D e p e n d a b le B u s in e s s a n d P r o f e s s io n a l S e r v ic e DRUGS DRUGS DRUGS The Best in D rugs and D rug Service. “ Prescriptions A ccurately Com pounded Hall Drag Co. Phone 141 M ocksville S T A T IO N ER Y AN D JO B PRIN TIN G W H ATEVER YOUR PRIN TING _ NEEDS— W E CAN DO THE “ JOB” rs£>|M jgT W f TO YOU R COM PLETE S A T IS P A C -^ U D ^ H f B TION. W e Represent zAfl mil R LEE SOUTHERN ENGRAVERS T H E M O C K S V IL L E EN T E R P R IS E Flour, Meal, Feed Stuff and Grain j. P. Green Milling Co. Phone 32 Near D epot M ocksville 0 Pure Crystal Ice 9 Coal for Grates, Stoves Furnaces and Stokers Mocksville ’ps & Fuel Co. Phone 116 9 Chrysler - Plym outh SALES & SERVICE £ International Trucks Davie Motor Company Phone 189 M ocksville ( WHArs your problfm? ) '-------------~ 7 /----------------------------- The business firms listed in this directory can be depended upon to solve any problem in their field. No matter what your problem might be — you may find the answer here. Lumber, General Building Supplies, Sheetrock, Plaster Smith-Dtiriggias Lumber Co. PHONE 233-J Salisbury H ighway QUALITY D R Y C LEA N IN G & LA U N D R Y M O C K S V IL L E LAUNDRY PHONE 190 ........ PAGE TWELVE THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 3,1953 Double Funeral Services for Mr. and Mrs. C. L. ThompsonCouple Die Within Fifteen Hour Period Double funeral services were held Saturday afternoon at the First Methodist Church in Mocks­ ville for Mr .and Mrs. Charles Lowe Thompson. The Rev. W. Q. Grigg, Rev. E. M. Avelte and Rev. George B. Cleminer officiated Burial was in the family plot at Rose Cemetery. -_________________2_______ A ^M IN IST K A T O R ’S NOTICE N orth CflTolirm—D nvie County-- . T ho undersigned, having qualified ns adm inistrator o f tho estate o f J» B. C ook, decenscd. Into o f D avie County, this ls to n otify nil persons, having claim s against said estate to present them to ih e undersigned on or before the 4th day o f D ecem ber, 1054, or this notice w ill be pleaded In bar o f their recovery. A ll persons indebted to said estate w ill please m ade im m ediate paym ent to the undersigned. . 12 3 Ctn T his the 1st day o f D eem ber, 1053, W . B, REN EG AR, A dm inistrator R . B . SAN FO RD , Jr., A ttorney. ATTEN TIO N VETER AN S O P FOREIGN W A R S—A ll eligible veterans are urged to put their M em bership • in good standing w ith the Thom as R ay Davis P ost 4024 o f the VFW . Contact Q uarter­ m aster Hanes Yates. D ues now payable lo r 1954. 12 3 Itn Annie Brinple Bride of James Thomas Cornatzer Miss Annie Beatrice Bringle, daughter of Mr. and Mrs. Lester! Lee Bringle of Rt. 1, Salisbury, j musicians. delabra holding calhredral tap- nosegay of pink carnations. She’ of North Carolina. They will ers. Family pews were marked added the bride’s gift, a pair of make their home at Valdosta, Ga. with white satin ribbobns. j rhinestone earrings. . | where ,he bridegroom is station- Mrs. Melvin Rice, pianist, and| Gordon Cornatzer was' his ed with the U. S. Air Force. Mrs. B. J. Cline soloist, were brother’s best men and Ehvoori became the bride of James Thom-1Mrs. Thompson, age 70, the formev Ruby- Viola Reavis, died gs cornatzer, son 0f Mr. and Mrs.! her father, wore a blue suit with‘ were ushers, at 12:05 p. m. on ^ Thursday, Qeorge Gierm Corntzcr of Rt.'matching accessories.-She held a Bringle, brother of the bride, and , Mrs- Cornatzer was graduated The bride given in marriage by! Floyd E. Swicegood, her uncle, Woodleaf High school. Mr.Cornatzer was graduated .from For her daughter’s wedding,Shady Grove High School, Ad- 1, Advance, in a double ring; prayer book topped with an or-' Mrs. Bringle wore a black suit vanco’ anci before entering the XLThanksgiving day, at home after. sufferng a heart attack. She had. ceremony solemnized Sunday, chid and showered with satin bean in declining hea th for sev-. No%^ 22, at five-thirty at Gayes ribbons and feathered carnations. er? l y^f!rs- „„ ,, , , I Chapel Methodist Church. Mrs. Harry Steele of Route 1, Mr. Thompson, age 78, died a so ^ T^e jjev. j q Swaim, pastor, ■ Salisbury was her sister’s ma- at the home on Churci Stiee a 0fj-jcjateci before a setting of floor iron of honor and only attend- 'ill for wvprM davs hav” 1 ba'skcts of gladioli and chrysan-j ant. She wore royal blue with'tibule of the church. They left a patient at Rowan Memorial Hos­ ing undei'gone a major operation ^ thomums> ferns’ Palnls and can-1 black accessories and carried a | later for a trip to the mountains pital, returned home Thursday. a short time ago. with a sorsage of red carnations. Force ‘n March of this year Mrs. Cornatzer chose black with he was with the Western Electric a corsage of white carnalions. Company, Winston-Salem. After the ceremony, the.couple —--------------------------------- received thior guests in the ves- Mrs. Will Beck, who has been Mr. and Mrs. Leroy Owens, Rt. 1, a daughter, Nov. 30. Mr. and Mrs. Joe MeDanel, o f' Cooleemee, a son, Nov. 1G. Mr. and Mrs. Quinton Smith,- a son, Nov. 20. Mr. and Mrs. Clyde Taylor,. Rt. 3, a son, Nov. 8. Mr. and Mrs. Coy Barnes, Ad­ vance, a son, ,Nov. 12. igiEieie««wts«ie«m««!e«i5«««fs««ig«5«!e^««^«si«is«i€ie!gigte!eig!si£(£f€is<i;iste-€te!gtei6t6i5!Slg!e* le(g«(gwe!eI5igie;[efgW!s!c;!S!5,5.^lc^ls^^!g!..g^le!SK51S(g!s^!g(6^,€!5.!eigtatg!c.1€lg!s!61g!sl5lg(e[eletslS!etetet,._ MO to operate,.. you can sete end change deiignt THE WOKID'S WIST AND ONLY tUlLY AUTOMATIC *’ sEwifte MActttm AUO *rw* WITH A DOUBLE NCEDLC (which it Mippttatf S 2 7 Q QS with th# ROBOT C. J. ANGELL APPLIANCE CO.■ MOCKSVILLE, N. C. Mrs. Thompson was the daugh- W ter of David I. and.Permie Conk- gf lin Reavis. She was born Sept. 15, 1883. She was registered ^ nurse and a member of the Mocks-, |J ville Methodist Church. i j* She is survived by one son, C.: y L. Thompson, Jr., of Mocksville; j one daughter, Mrs. Benson Jones, £ of Beauford, Ga.; three brothers,1| William H. Reavis of Washing-.» ton,,Carl C. Reavis of Winston-, Salem, and H. M. Reavis of New- i jjj port News, Va.; three sisters, Mrs.!» William H. McMahan of Albe- ‘ w querque, New Mexico; Mrs. Vel-. y ma Zink of Daytona Beach, Fla.;1 ^ and Mrs. H. S. Williams of Con- "* cord. Five step-daughters; five' grandchildren and five step-' grandchildren. C. L. Thompson Mr. Thompson was born in Da vidson County, Oct. 3, 1876, son; g of Josepli H. and Cornelia Mock j g Thompson. For 12 years he was;g a retail merchant in Advance,' y moving to Mocksville approxi-; S mately 40 years ago. He was thej founder of Thompson Wholesale Company, now known as Thom.p-. son and Son. Mr. Thompson was married three times. His first marriage was to Miss Bertie Furches. After her „ death, he married Miss Mary. § Henry. Following her death, he married Miss Viola Reavic 1918. Surviving are one son, C. L, Thompson, Jr., of the home; six daughters, Mrs. Benson Jones of Beauford, Ga.; Mrs. W. R. K es-' ter, Mrs. F. G. Woodruff and Miss Sue Thompson of High Point; Mrs. Ralph Ratledge of Advance;' Mrs. Rufus Ratcliff of Waynes-, ville; one brother, Odell Thomp-' son of Washington, D. C.; and. four sisters, Mrs. H. U. Oakes and Mrs. Joe Barker of High Point; Mrs. Arthur Ripple of Welcome; and Mrs. Alston Moten of Wash­ ington, D. C. Pallbearers for Mr. Thompson were C. H. Tomlnson, George Shutt, W. N. Smith, W. B. Le- Grand, Knox Johnstone and Lonnie Dwiggins. Pallbearers for Mrs. Thompson were Henry Cole Tomlinson, Gor­ don Tomlinson, Jimmie Ratledge, John H. Williams, James H. Stine and Clarence James. i - ' • '• ! *•- A'-* '• '■ ' .j • ••» ri : vt. .... , ,yj « . * ... ■ v ." 1 ' ' v4 CHOICE WESTERN—CENTER CUT Round Steak 69c B rrrr in S LIBBY’S REFRESHINGI jj ORANGE JUICE............ . 46 oz. can, 31c g nrvr& v cpD & vCRANBERRY SAUCE..... . .... .303 can, 19c •I Win A Pop Corn POPPER and Four ^ SERVING BOWLS FREE. Just Register at the Pop Com Display. ii ,.V % \ W ^ W W W W W W A W V \ W .,. V W ^ W . W A W / A W J *»®8!:9!a)»3!S)9ia!a!3!S)»»*3iaa!aiM!3l»3»!a3i&»3t»iai»»»iai»»iaiJlSl»lS!S3!SiS:JI Oranges Apples 81b bag 49c 5 lb bag 63c % VEGETABLES g NEW RED BLISS* POTATOES........................6 lbs. 59c FIRM LARGE HEADSLETTUCE ...............:.2 for 29c»yM if V » a ^ GARDEN FRESH* MUSTARD SALAD ...............2 lbs., FRESH GREEN TOPPEDTURNIPS......................2 bunches for 29c 29c Tender — Flavorful Cube Steak 69c lb Armour’s Banner Bacon 1 Ib pkg 59c C^ROLIf^ TREET Heffner & Bolick BARBECUE CHICKEN J je e Vegetable Swiss Steak XVi lbs. rtufld 1 can vegetable steak, ¥z in, thick »oup(see note) Vi cun wvter 2 Tablespoons float 2 Tabfetpooas finely1 teaspoon salt cut onion £6 teaspoon pepper VS cup Pec2 Tablespoons Evaporated Milk hoc fee Cut steak into serving pieces. Mix on a piece of paper the flout, salt and A Tasty Treasure of Flavor, Texture and Aroma is 4 pepper. Spread half of flour mixture on yours to take home. Its Tenderness is barbecue sealed «* a board. Lay pieces of meat on the flour in that Crisp Russet Sauce Coating. Try this heavenly 4 mixture, then sprinkle rest of it over the Taste Treat in Barbecued Chicken and you’ll try it S meat- Pound meat with edge of saucer again and again and again. «* to force flour mixture into it, turningTasty, Delicious, The Rotiss-O-Mat Way- * S " tdefin \. J* skillet in hot fat. Mix soup, water andMrmnu 4 on‘°n. Add to meat. Cover and cookMEDIUM .Jffm very slowly V/i hours, or until meac isMEDIUM ''1'^iia 4 Oysters pint 79c \tender. Remove meat to warm platter, rrf & t1t % I PAN READY—FRESH Flounders 49c lb i then stir milk into liquid left in skillet, if Heat until steaming hot, but do not boil. Serve hot, with the steak. Makes«J 4 servings. sf NOTE: Lean slices of beef, veal or lamb % shoulder or chuck also can be used. K 5 s 4 N DIXIE XTAL ,» DIAMOND DEE—EXTRA SOFT *-. e" —. ;■ 25 FT ROLL INITIAL BUCKLE and BELT SET i Genuine Mother-of-Pearl Buckle ~7& ^ Z M « , ..idually his! Modern initial on a gleaming genuine mother-of-pearl panel ■. . . set against an etched background. The finest hand-stained leather. We’ve his initial,, , his size. All irift ; ’■ -':nged! Ready for you now! The set • gift packaged SUGAR ... 5 lbs., 49c 10 lbs.,..'97c V, TOILET TISSUE.....4 Rolls, 39c J TIN FOIL 15c 5 Sk S' f iA W .M .W .* n M m m _______________________________________________________________________________V £V IW W W W U % W . AJAX CLEANSER 2 for 27c ALL SOAP PRICES INCLUDE N. Ci SALES TAX CASHMERE BOUQUET SOAP 3 Reg. bars, 25c Peter Pan SOAP 3 reg. bars, 25c ITrexIer Bros. Inc. “SALISBURY’S STORE FOR MEN” | Salisbury, N, C. v . v . v . v . v . w . v . v / . ,. v . v v . v . v ,. v , v . v . v . v . v . v . v . v . v H e ffn e r & B olick G rocery- S U P E R M A R K E T I w w w w i w y w w w w w y v w w w w w / w v w w w w f t i w y v w w w w f t w w v w v w w w v w w w w w m v t f A v w w w h v w w w v w w w VOLUME XXXVI All The County News For Everybody MOCKSVILLE, N. C., THURSDAY, DECEMBER 10, 1953 ‘,A11 The County News For Everybody"No. 42 J. C. CLONTZ ACCEPTS TROPHY denoting foo'ball award ' from G. H. C. Shutt at the annual banquet last week. Football Coach Ray Delapp, extreme left, and Edgar Dickinson, at right, President of the Mocksville Junior Chamber of Commerce, look on. iThis is an annual award by the local Jaycees. J. C. Clontz Wins Jaycee Annual Football Award J. d. Clonz, stellar pwfovmer on the Mocksville high school six- man football team the past year, received the Jaycee “most valu­ able’ player award for 1953. The award was presented at the an­ nual banquet honoring members of the football squad last Thurs­ day night. This is the first time the award has ever been won by an under- classman. The selection was based on the boy, in Jth'e opinion, of the selection committee, that contrib­ uted the most to' the success of the team;, the one that displayed the best team spirit, cooperation, and attitude both in the game and on the practice field. G. H. C. Shutt, chairman of the selection committee, present­ ed the award to Clontz. Jaycee President, Edgar Dick­ inson presided over the program. Paul Richards welcomed the foot­ ball players on hebalf of the Jaycee Club. Mr. Richards point­ ed out that the Jaycees were be­ hind the school athletics and that participating in athletics could prove of an immense value to the boy. Following the presentation of the trophy a movie on the tech­ nique of basketball play and of­ ficiating was shown to the group. Robert Latham presented Coach Ray DeLapp with a gift on be­ half of the members of the foot­ ball team. Officers Nab Two Prison Escapees Two convicts who escaped on Jvov; Iti from a road garig'rieaf the Caldwell County Prison Camp were recaptured by state high­ way patrolmen and Davie County sheriffs deputies on Saturday. The escapees were identified at Willie Brendle, 38, of Lexington, serving 18 months for driving after his license had been re­ voked, and John Bassett, 28, of 711 Moravia Street, Winston-Sa­ lem, serving 12 months for non­ support. Brendle was taken into cus­ tody at the home of Will Myers near Advance by State Highway Patrolman T. J. Badgett, Davie Sheriff Alex Tucker and Deputy Millard Godbey. Bassett was apprehended by Patrolmen Badgett and A. W. Cox on Highway 158 in Forsyth Coun­ ty near Clemmons at approxi­ mately 8:30 p.m. Saturday. The patrolmen said that Basett was walking along the highway with a woman identified at Mary Ellen Padgett of Martinsville, Va. Winston-Salem police that Bas­ sett also was wonted by Martins­ ville, Va., police for larceny. The warrant has been forwarded to state prison authorities, the of­ ficers said. Both men have been returned to the Caldwell County Prison Camp near Lenoir, ?vt. Duke Ratidege At Fort McClellan s v"*-' %' * 1 Pvt. Duke. M. Ratledge, Jr., has recently finished his basic traning .?t Fort Jackson, S. C., and is now stationed at Fort Mc­ Clellan, Alabama, and attending the C. B. R. School. He and his wife are living at the present in Anniston, ,Ala­ bama. J. A. Spillman Promoted To Corporal John A. Spillman, 23, whose wife lives in Mocksville was re­ cently promoted to corporal"with the 4rd Infantry Division in Ko­ rea. Cpl. Spillman, son of Mrs. A. G. Turner of Mooresville, is a cook with the 3rd Battalion’s Clearing Medical Company.’ He has been in Korea since March and holds the Korean Service Ribbon with two campaign stars and the UN Service Ribbon. Kiddie Show December 19 A toy' will be the price of ad­ mission at the "Kiddies Show” scheduled at the Princess Theatre on Saturday morning, Dec. 19, at 10 a.m. Toys collected at this show will be turned over to the Mocksville Junior 'Chamber of Commerce to supplement the results of the “Bundle Drive” scheduled for Sunday afternoon, Dec. 13. This collection will be distributed among the needy of Davie County, Mr. and Mrs. Frank Fowler have announced that they have arranged cartoons, comedies, sport shores, etc, for the showing on this morning. They join the local Jaycees in urging everyone the same time contribute to a worthy endeavor. The date is not this Saturday, but Saturday, Dec. 19, at 10 a.m. to attend, be entertained, and at Dr. Connell, 47, Courtney Pastor, Dies Funeral services for Dr. Ray­ mond E. Connell, 47, were held Monday afternoon at the Court­ ney Baptist Church of which he was the’ pastor.. Dr. Connell died at 6:30 a.m. Saturday in a Waynesville hos­ pital. Death was attributed to a heart ailment. Rev. Charles Coffey of Kanna- po'is, the Rev. J. P. Davis of Mocksville, and'the Rev. Doug­ las Branch of Rocky Mount con­ ducted the funeral services. Bur­ ial was in the Memorial Ceme­ tery in Kannapolis. ' Dr. Connell was" stricken by . a heart a.'.tack on Nov. 27 while on a deer hunt some 16 miles from Waynesville. He became ill after climbing approximately 400 yards to his post in the. woods. At the time Dr. Connell did not realize the seriousness of his ill­ ness and instructed friends in the, ]iuntin£ party to continue their hunt. He made his way down the mountainside and drove back to Waynesville to seek medical at­ tention. He had remained in the hospital at Waynesville since then. Dr. Connell was born in Meck­ lenburg County, son of John and Margaret Robinson Connell. He moved with his parents to~Kan- napolis at an early age and lived there until young manhood. He attended Wingate Junior College, Wake Forest College and received his bachelor of arts de­ gree from Catawba College at Salisbury. He later attended the Southern Baptist Seminary in Louisville, Kentucky, and receiv­ ed a master of theology degree and later was awarded a doctpr of theology degree. While working towards his doc- (Contlnued On Page 12) LIBRARY NEWS The Davie County Public Li­ brary Board of Trustees is right­ fully proud of the job the Book­ mobile is playing in the distri­ bution of books to our citizens. At the begnning of bookmo­ bile service in the county, only four days were necessary during the month to meet the demands, since then a fifth day has been added and now, the Board realiz­ es that another day during the month is necessary. The annual report on July 1, ,1953, revealed that 48,667 books were circulated by Mrs. Etchison from the bfaok- mobile for home and school use. The first six months of the new year show that there will .be a large increase over that for- the current year. , It is with pride and pleasure that the Public Library announc­ es an additional day for the bookmobile. ---------• FIRST WEDNESDAL, RT. 1. Leave Mocksville 9 a.m., Davis Store, 9:10; D. C. Clement Horne, 9:30; Boger home, 9:40; Ball Stoue 10; W. R. Davie School, 10:20; Robert’s Store, 11:20; ' Merrell House, 11:50; Driver House, 12:20; Cana PO, 12:40; Pope Home, 1:30; Leagans Home, 1:30; Wade Groce Home, 2:00; Odell James, 2:20; Harding homo, 2:40; McMahan home, 3:00; Mocksville. a FIRST THURSDAY, RT..2 Leave Mocksville 9 a.m.; Benn­ ett’s store, 9:20; Farmington school, 9:40; Bahnson Home, 11:- 40; Smith Home, 12:40; James Home 1:00; King’s Store, 1:30; Es-ic Hobe, -2:00; Smith Home, 2:20; Cook Home, 2:30; Mocks­ ville. . ' SECOND WEDNESDAY, RT. 3 Leave Mocksville 9:00; Cornat­ zer’ store, 9:20; Bixby,; Advance School, 10:00; Faircloth Home, 12:00; Vogler’s Store, 12:30; Bail­ ey’s Store, 1:00; Tucker’s Home, 1:30; Young Home, 2:00; Fork Church, 2;40; Mocksville, SECOND THURSDAY, RT. 4 Leave Mocksville 9:00; Hendrix home, 9:20; Smith Grove: Claw- son ’ home, 9:45; Smith Grove School, 10:10; Taylor home, 12:30; Poindexter home, 1:20; Hartman home, 2:00; Mocksville, Cotton Growers To Receive Acreage Allotments Soon Davie County cotton growers will receive official notice of their 1954 farm acreage allotment for cotton in the next few days. The notices are now being mailed by the County ASC ‘Committee of­ fice. Cotton acreage allotments for Davie County farms were deter­ mined by the County ASC Com­ mittee in accordance with the law and regulations issued by the Sec- rfetary ^pf Agriculture. They are based upon the national acreage allotment of almost 18 million acres which the Secretary pro­ claimed for upland cotton last Oct. 9. The allotment for Davie County farms is based on an ap­ portionment of the national allot­ ment to the State and an appor­ tionment of the State acreage al­ lotment to the county. The county allotment is distributed to farms on which cotton has been planted in any one the past three years. A small reserve is .available for specified u'-.es. . Farmers who do not intend to operate the farm for which an allotment for 1954 is established should immediately return the official notice to the County ASC office so that it can. be sent to the person who will operate the farm in 1954. Any-changes in the land to be included in the farm for which the allotment'is made “should be reported to the County Commit­ tee. Or . if- there is any question about the' farm on which the al­ lotment is established, the farm operator is requested to be sure to check with the Davie County Committee. Bundle Drive To be Sunday The Jaycees annual bundle drive will be held Sunday at 2 p.m. Sheek'" Bowden, Jr., Jaycee chairman of this activity, has re­ quested that all those having dis­ carded clothing or toys to put them in a bundle and place them on the front steps of their home. A truck will come by sometime after 2 p.m. and pickup these items. The collection from this bundle drive is turned over to the Davie County Welfare Department who in turn distributes the 'items among the needy in the county. Each year the clothing and toys obtained from this drive helps to make £ happier Christmas for several Davie County families. James R. York Is Named President Of .......N. C. Folklore Society 1954 Town License Plates Now On Sale Town automobile license plates, to be displayed on vehicles of Mocksville residents, are now on sale at the Town office. Mayor John E. Durham called the a'tention of the public to Chapter G, . Article 11, Section 4, of the Town Ordinances which state: “Every motor vehicle operated on the streets of the Town for which registration is- required, shall throughout the current is­ sue year display the assigned Town number plate or sticker in such a manner in front as to be visible at all times. Violation of this ordinance shall be consider­ ed a misdemeanor. Any person, firm or corporation violating any of the provisions of any section of this Code, or failing, neglecting or refusing to comply with same, shall be upon conviction, guilty of a misdemeanor and subject to a fine not to exceed $50 or imprisonment not to . exceed 30 days, and each day that any of the provisions of this code are vio­ lated shall constitute a separate offense.” ' New town license plates must be displayed after Jan. 31, 1954. 4 Inducted From Davie Four Davie County registrants were inducted into the Armed Forces on Dec. 3. Seven more re­ ported for pre-induction examin­ ations on Dec. 7. Names and addresses of those inducted were: John C. McEwen Route 2. Hobart Leie Carter, Advance, Route 1., Robert Mason, Jr., Mocksville. William Matthew Pulliam, Rt. 4. The VFW furnished'these men with cigarettes and'drinks prior to their leaving. Escaped Convicts / Arc Apprehended The two convicts that escaped from a . Davie County road gang on November 30 were apprehend­ ed last Thursday in Jonesville and Elkin. The. convicts, Alton Dowd and Earl May'e, both Negroes, walked away from a Davie County road gang on Nov. 30, and got rooms with a woman in Jonesville. Maye then wrote a letter' to his mother telling her o f . his whereabouts and gave the letter to a boy. The boy turned the lett­ er over to SBI Agent John Ed­ wards. Officers immediately went to the rooming house, but tile Con­ victs had fled. Bloodhounds picked up Dowd’s ‘tttftt'aiKt'iTff'was captured income woods less than a mile from the house. Maye was captured later in the afternon at the Elkin bus (Continued on Page 12) Cotton Marketing Quota Referendum on Dec. 15 Pfc. Jesse Williams Serving In Korea ^ 's \ Pfc. Jessie R.’ Williams, above, son of Mr. and Mrs. R. H. Will­ iams, is . now stationed in Korea. He entered service in February, 1953, and took his basic training at Fort Jackson, S. C. He is married to the former Miss Kath­ erine Chandler. Early Christmas Mailing Is Urged The Post Office Department has annually issued a plea to the public to mail Christmas packages and cards early in the season but this year there is a new and more urgent reason for early mailing, J. .E. K'elly, acting Mocksville postmaster, announced. Clerks cannot stop to ponder over an illegible or incomplete address on one package while hun­ dreds of other packages are wait- ing for handling. Therefore these improperly wrapped or packaged parcels are laid aside and handled after the rush is over and that means after Christmas, he ex­ plained. To assure packages of arriving at their destination promptly and in good shape, the following rules should be followed: Pack your gifts in good strong boxes with plenty of padding to prevent crushing or breaking. • Do not put letters or notes in parcel post packages. A written greeting such as “Merry Christ­ mas, with love,” is permissable. Your return address- must be on all parcel post. Insure your packages against loss or damage. If the package contains any liquid or is fragile use extreme care in packing and be sure to tell the post office clerk the na­ ture of the contents when you mail it. . _. Mr. Kelly said that all Christ­ mas cards must have a two-cent stamp on them if not sealed.'He recommended that citizens place a three cent stamp on the Christ­ mas cards so that they could be forwarded on as first class mail. This would insure delivery, he said. Clarksville Community Wins In Davie Contest James R. York of Mocksville, Route 2, was elected president of the North Carolina Folklore So- city at the 42nd annual meeting held in Raleigh last week.. He succeeds Dr, I. G. Greer of Chapel Hill as president of this organization. He served this past year’ as vice-president, Due to the absence of Dr. Greer, Mr, York presided over the 42nd annual 'meeting held at the Sir Walter Hotel in Raleigh. A year of cooperation in im­ proving their community paid off Clarksville last week when their community was selected as winn­ er of the Davie County Commun­ ity Development Program. The judges were Miss Ruth Cur­ rent, chief of the state home dem­ onstration agents, Raleigh; D. S. Rhyne, chairman of the Product­ ion and Marketing Association Committee for Gaston County; A. G. Bullard, department of. agricultural education, State De­ partment of Public Instruction, Raleigh. The contest was sponsored by the Winston-Salem Chamber of Commerce, For winning the Davie County Community Development P.r o- gram, Clarksville community will receive a plaque. Pino..Commun­ ity will receive red ribbons and the Center community will be awarded a white ribbon. Clarksville began their concert­ ed action early this year with a clean up of grounds about their community building. Their work went on rapidly from that point to embrace im­ provements in nearly all phases of community life. Family-wide participation was stressed in the program, Two kinds of reports were sub­ mitted to the judges: 1. Individual family score sheets. These recorded general farm work, improvements, and participation in community ac­ tivities, 2. Scrapbooks containing narr­ ative reports, many handsomely .illsutrated with snapshots of the year’s work and future goals. O. E. Driver served as chairman of the Clarksville program. Mrs.! Vote Will Determine Level of Price Support The outcome of the cotton mar­ keting quota referendum to be held throughout the Nation’s cot- ton-growing area December 15 will determine the level of price, support for cotton produced in 1954 and therefore is of vital con­ cern to every cotton grower, says O. E. Driver, Chairman of the Davie County Agricultural Sta­ bilization and Conservation Com­ mittee. I The marke'ing quota program j will be in operation for next year’s I crop, the chairman explains, if at least two-thirds of the votes cast in the referndum are in favor of the program. In that case the grower who stays within his acre­ age a’lotment will be eligible for 90 per cent of parity price support on his- 1954. cotton. If his farm has more cotton acreage than the allotment, he will be subject to a 50 per cent of parity penalty on his excess cotton. If more than one-third of the votes are against quotas, the price support level to cooperattors drops to 50 per cent of parity.- Whether the vote is favorable or unfavorable, no price support, will be available on cott­ on for the grower who overplants The choice before cotton grow­ ers, according to Chairman Driv­ er, essentially is whether or not they want a reduced acreage and 90 per cent of parity price sup­ port. He explains that acreage allotments will be in effect even though quotas are diapproved and that compliance with such allotment will be required for eligibility for price support at 50 per cent of parity. He suggests that specific ques­ tions which each grower will want to answer for himself are: - Will my prospective income be greater from the allotted acreage and 90 per cent of parity price support, or from an unlimited acreage and whatever the market will bring the crop? What effect will this decision have on my income in future years in the light of cur­ rent and prospective large sur­ plus supplies of cotton? What would be my decision if I could decide for all the cotton growers in the country? Chairman Driver emphasizes that he cannot and will not indi­ cate how cotton growers should vo'e;‘ -but he emphatically urges all growers to vote in the refer­ endum. In his opinion, the decis­ ion will have far-reaching effects and the question deserves the serious study and the carefully considered vote of all who grow Cotton. . The referendum will be held between the hours of 8 a.m. and 6 p.m on. December 15 at the following polling places: North Calahaln, Center Com- muni’y Building; South Calahaln, Smoot’s Store; Ea".t Clarksville, Roberts’ Store; West Clarksville, McClamrock’s Store; North Farm­ ington, E. C. Hendrix Store; South Farmington, Smith Grove School; West Farmington, Clyde James’ Store; North Fulton, Community building; Sou’ll-Fulton, Commun­ ity building; North Jerusalem, Greasy Corner (Rambeu’s Store) South Jerusalem, Rambeau’s Store; North and South Mocks­ ville, Court House; East Shady Grove, G. A, Potts’ Store; West Shady Grove, J. H.' Robertson’s Store, 1 Postal Receipts Totals Are Given Postal receipts for the Mocks­ ville post office for 1953 give every indication of surpassing the receipts of previous years. Receipts from January through November totalled $35,269.89, To- toal receipts for 1952, the entire year, amounted to $38,227,57. Receipts for the month of No­ vember, J953, amounted to $3,- 798.36. This exceeded the receipts for-the like: period in 1952 by $556.57, the total for November, Bill Merrell served as secretary. 11952, being $3,241.79. PAGE TWO The Mocksville Enterprise Published Every Thursday at Mocksville, North Carolinn MR. AND MRS. EUGENE S. BOWMAN...............................Publishers GORDON TOMLINSON ...................................................................Editor Entered at the P ost O ffice at M ocksville, N. C., as S econ d Class M atter U ndei A ct of C on gress o f M a rch 8, 3879 ' ir ~ jtarth Carolina ASSOC l ATI r if. The Last Polio Battle? W h a t m ig h t be th e last m a jo r ba ttle in m a n ’s attem p ts to solve the terrible pu zzle o f p olio w ill b eg in F eb ru ry 8, 1954. A t th a t tim e, th e n ew est a n ti-p olio va ccin e w ill be u sed in qu an tity. O ver 200 cou n ties in th e U n ited S tates w ill be a ffected in th e m ass v a ccin a tion a ttem p t, w h ich is on e o f th e la rgest p rojects o f its k in d ever u n dertak en . T h e n ew est va ccin e is a triple-vaccin e, a n d its developers h op e it w ill prove fa r m ore effective th a n th a t u sed in tests th is sum m er. A p p roxim a tely 500,00 to 1,000,000 ch ild ren w ill g et sh ots o f th e n ew va ccin e in th e drive w h ich begin s in F eb ­ ru ary. T h e im m u n ization drive w ill p rob a b ly sta rt in L ou isan a, T exas o r A labam a, w here p o lio strikes earliest in th e year a n d th en in clu d e oth er states. T h e im m u n iza tion e ffort is sch ed u led to en d p rior to su m m er, w h en p o lio b e­ g in s to strike. C h ild ren w h o receive th e in jection s, con sistin g o f th ree sh ots over a p eriod o f five o r six w eeks, w ill take th em o n a v olu n ta ry basis. It is estim ated th a t m ost o f th e in jection s w ill be given to sch ool ch ild ren o f secon d -g ra d e age. T h e grea t h op e co n ce rn in g th is n ew seru m is th a t it w ill provide im m u n ity a ga in st ea ch o f th e th ree k n ow n types o f p olio virus. A fter th e v a ccin a tion o f a la rge n u m b er o f ch ild ren betw een F ebru ary. 8 a n d Ju n e 1, exp erts w ill keep records o n th e ch ild ren ,an d th e su ccess o f the im m u n ization shots, a s th e p o lio season develops in 1954. I f th e va ccin e lives jip to w h a t som e e x p e ct it to, resu lts m ig h t sh ow th a t an jansw er to p olio h a s a t la st b een fou n d . Huitm 3s Born, -----BY CLIN T ^ BONNER Joy to the W orldNeither poet nor composer knew he was writing a Christmas caroi THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 10, 1953 Of the statues In Westminster Abbey one Is of Isaac Watts—frail, sickly, gentle-mannered literary genius of the early 18th century. Another is of George Frederick Handel—massive, robust and hot- tempered master of the keyboard and opera. Both men lived In London; both know cach other. But neither suspected that their talents would be com­ bined to produce one of the greatest of Christmas carols.lt was In 1719 that pockmarked flve-foot Isaac Watts wrote a hymn based on the 98th Psalm. He was 45 years old and had written, among 600 other notable hymns, "Alas, And Did My Saviour Bleed," “O God, Our Help in Ages Past" and “When I Survey the Wondrous Cross." But the little bachelor's health had broken while he was preach' many Handel had persuaded his father to let him study music instead of law and wound up playing a church organ In England. And when George Handel later cast Ills talents with the theater he carried his religious training with him. At SG Handel wanted to do something really big. ’And he did. In 1741 he worked and prayed almost continuously for 23 days and nights and came up with his Im­mortal "The Messiah." It was such a masterpiece that for two centurlcs the piece has been drawn on as tho basis for numerous compositions.Little Isaac Watts died on the Abdney Estates In 1748 after his visit «f "a week" lasted 3G years. He was buried In Bunhill Fields but a statue of him was placed In Westminster Abbey. Eleven years later big George Handel was laid to rest In the MANAGER? . ford, ambitious, Ing at London's Mark Lane Church art! Lord Mayor Poets’ Corner of The Abbey where a statue stand* Abdney carried him out to his estate (or a week's to the memory of the theatrical genius who never rest. That was In 1712 and he was still there seven forgot God.years later writing children's verse, Bymns and It was In 1836 that Boston's choir director-com- books on a dozen subjects. poser Lowell Mason rearranged a portion of Twenty-two years after Watts wrote his tiymn on Handel's “Messiah" to fit the hymn Isaac Wattsthe 98th Psalm and published It In his "Psalms of wrote in 1719. And so, while the big statue and David Imitated" a big fat theatrical producer knell the little statue stand In Westminster Abbey ai In prayer In another part of London. He was George Frederick Handel and he had written some oi the world's greatest operas. As a boy In Ger- .Joy to the world! the Lord Is come;Le* earth receive her King Let every heart prepare Him room And heaven and nature sing. Joy to the world! the Savior reigns; Let men their songs employ; While fields and floods, rocks, hills and plains Repeat the sounding joy. mute reminders of two geniuses tn their respective fields, tribute is paid both every Christmas to the resounding echoes of . . . No more let sins ond sorrows Qrow Nor thorns .Infest the ground;He comes to make His blessings flow Far as the curse is found. He rules the world with truth ond grace, And mokes the nations prove The glories of His righteousness And wonders of His love. From The Book, -A HYMN IS BORN” Copyright 1952 — WILCOX-FOLLETT CO., Chicago, Illinois. Retail Sales T o ta l retail sales in D avie C ou n ty fo r th e fisca l yea r en d in g J u n e 30, 1953, w ere 6 m illion 779 th ou sa n d dollars ($6,779,000), o r $439.62 p er capita-. F o r th e fisca l yea r en d in g th e p reviou s Jun e, tota l sales w ere six m illion 332 th ou sa n d ($6,332,000), o r $410.64 p e r capita. T h is m ean s th a t sales in crea sed in D avie C ou n ty d u rin g th e year b y $447,000, or 7.05 p er cen t. T h e R ep ort o f th e N orth C arolin a R even u e D ep a rtm en t sh ow s th a t D avie C ou n ty h a s a tota l o f 238 retail m erch a n ts &nd ran ks 64 in th e States a ccord in g to retail sales. M eck­ len b u rg C ou n ty ran k s a t th e to p in retail sales. Sanitation Ratings In Jan u ary 1946, a survey o f m ark ets a n d restau ran ts in D avie C ou n ty show ed ^that th e p la ces in sp ected h a d d rifted to very low stan dards. N o p la ce in th e cou n ty w as given m ore th a n a “ C ” ratin g. S a n ita ry con d ition s in a n d a rou n d M ocksville w ere term ed deplorable. < T h e survey at th a t tim e w as m ade b y W . M urray, L in k ­ er, Jr., o f th e State B oa rd o f H ealth a n d C arl E. Sh ell, w h o a t th a t tim e h ad ju st been a p p oin ted S a n ita ria n o f th is district. • . . , ■ 1 " F ollow in g th is in sp ection several p la ces w ere closed u n til arrfcigei«ente*tfs*~fateU ig ^h-cir'^'te'idK rdo'w exe -nm de: A s a result, th is m a tter a lm ost en tered th e rea lm o f co n tro ­ versy, a ccord in g to a rticles a p p ea rin g in th e .new spaper. O ne m a n w en t so far as to w rite in an d say th a t “ th e average p a tron does n ot seem to care h ow slop p y th e p la ce is.” T h a t w as a lm ost eig h t years ago. T h is is 1953, an d recen tly a n oth er in sp ection revealed th e ex a ct opp osite con d ition s existin g in 1946. T lie resu lts o f th is m ost re­ cen t in sp ection , as p u blish ed in T h e E n terprise la st w eek, sh ow th a t D ave C ou n ty tod a y does n o t h ave a sin gle ea tin g esta b lish m en t ra tin g as low as a “ G rade C .” A ll are “ G rade B ” or b etter a n d th ere are 13 “ G rade A ” ea tin g p la ces in th is cou n ty. A ll this speaks w ell for D avie C ou n ty. It is an enviable record for th ose w h o are in the business o f servin g th e p u b ­ lic. It also speaks w ell fo r S an itarian C arl E. S h ell a n d th e D avie C ou n ty H ealth D epartm en t. T h rou g h th e gu ida n ce o f M r. S h ell a n d th rou g h th e efforts a n d u n d ersta n d in g o f th e operators o f th ese ea tin g establish m en ts, D avie C ou n ty h as com e a lon g w a y in th is field. 60 Second Sermons By FRED DODGE W V .W \ W \ W W W A W .V .W A V .W ., .V \ V V W .\ W W ! Washington Notes Democrat "of 'bo Cape Fear Coun­ try last Saturday afternoon was named ai chiel aide of Kerr Scbtt, who is now reyarded as a cer­ tain candidate for the U. S. Sen- i ale. It is interesting to nolo that Sanford, former president of (he Young Democrats of North Caro­ lina and n State Senator serving his lirst term, might right now be administrative assistant to Senator Alton A. Lennon were it not for the fact that he i" from Lennon’s Congressional District, and nould. therefore, add little to the Wilmington hustler's strength Sanford, 36, lives in Fayette­ ville. Tn the State Senate last, soring, he and Sen. Ralph Scott of Burlington, brother of Kerr, usu­ ally voted the same way. Another in the same group was Senator Arthur Kirkman of High Point. Despite the fact that Sanford lives in Senator Lennon’s Con­ gressional District, he was felt out regarding going with Lennon about Hx weeks ago. When he re­ fused to listen seriously to talk of this kind, it was agreed that— sooner or la‘er—he would line up with Ker Scott in some capa­ city. It is understood Sanford will work without salary. If Kerr Scott can’t get an old­ er, more experienced man, Terry Sanford . manager. J A slow-talking, sincere kind of ! I fellow, Sanford carried right ' much weight for a freshman in Terry San-j On the other side is Griffith’s mild-mannered; en'erpretation of Romeo and Ju­ liet. It’s all a scream, no less, and ought to make millionaires, thou- sandaires, or something of Or­ ville Campbell, Griffith, et als. Campbell is the boy—native of Hickory—whe recorded “Way Up in North Carolina” and the Choo Choo Justice rcc&rds. The three Raleigh radio sta­ tions—WPTF, WRAL and WNAO —were given the record on the morning of the recent Notre Dame-North Carolina game. Af­ ter the first play on only one of the three stations, Raleigh switch­ board were jammed. They were. More on this later. ■ . W M W W . '. W . W S W . W W W V W . W A '. ’.W A V A W i I , L , ,the Legislature of 3953. He has ional elections. Congress meets an easy way with him and shou]d again next month and the major-' be of greathelp to Kerr Scott in ity party will have to put through the .-survey-. the former Gover_ farm and labor legislation along nor says he'is malcing regarding with many other bills constitut- his candidac'’ ing the President’s program. 'TEXT: “Man can be cured of every folly but vanity."—Rous­ seau. George. Washington Carver, the great Negro scientist, once told of a man in his community who kept a mule so lean and hungry that it could scarcely stand.^ One day when this follow drove his mule to town, the animal was observed wearing a new straw bonnet. “Well, Uncle Mose,” someone observed, “your mule would be much better off with less millin­ ery and more oats.” Benjamin Franklin put more emphasis oil economy than ex­ travagance. Even when he could afford better, Franklin dressed arid ate simply, to earn the es­ teem of associates. Today, we have reversed the thinking of Franklin’s day. Men are judged more by the elegance of the bonnet on the mule than on the mule. Perhaps that is why so hany human “mules” collapse and die at an early age. The simple, sound practice of feeding the mule is forgotten. We tie on a new bonn­ et and race for a new show-piece Unquestionably th e Russian note suggesting a Big Four for­ eign ministers meeting in Berlin sent a ripple of hope through many of the western capitals. There is probably little justifica- j tion for the hope, but the free world likes lo hope, and so there’s much current speculation about the possible easing of internat­ ional tension. Washington was inclined to view the ,-Soviet invitation with restraint all along, but London and Paris responded to the Moscow note with enthusiasm. The fear in some Washington quarters is that the French, or perhaps the Brit­ ish, will be inclined to concede too much in exchange for Com­ munist promises, which are worth­ less. As long as Sir Winston Church­ ill is in power, the British prob­ ably will not fall into that trap, but the French are anxious about the war in Indo China, burdened by continuing casualties, and torn asunder by over a million Com­ munists within the country it­ self. Churchill has actually been more keenly aware of the Com­ munist threat for years than some Americans. In 1944 he plugged hard for a jump-off into the Bal­ kans from Italy, instead of the in­ vasion of southern France, sens­ ing the imminent threat of^ Com­ munism over the Balkans. Gen­ eral Mark W. Clark recently told a reporter that he agreed with Churchill in 1944, but was over­ ruled by Washington. (Clark was commander of the U. S. Fifth Army at the time). M ost d en u n cia tion s are m otiva ted b y ign ora n ce, R ea l leaders are n o t too con cern ed w ith b ein g pop u lar. R even gin g an en em y m a k es y o u b u t eq u a l w ith h im — torg lv in g sets y o u above h im . to~"parade before our neighbors. Prayer meetin’g is held hero every Friday night at 7 o’clock at the church. Flake Sammons is the prayer band leader and invites each and everyone to attend. Mrs. John Lagle and son spent a few days last week with her parents, Mr. and Mrs. G. L. Fos­ ter, in Dulins. Joe Long, son of Mr. and Mrs. Connie Long, spent the week end in Winston-Salem with relatives.- Mr. and Mrs. Jack Carter of Mooresville visited her parents, Mr. and Mrs. L. F. Wagoner, re­ cently. Several in this community have been ill with colds the past week. Mrs. E. C. Lagle spent Thurs­ day with Mrs. S. B. Cooke and family, Mr. and Mrs. William Roberts and girls of Conover spent the week end with her parents, Mr. and Mrs. W. B. Wilson. Mr. and Mrs. Carole James and Mr. and Mrs. Charles James were Sunday dinner guests of Mr. and Mrs. Tommy Lagle. -. Churchill single-handedly sav­ ed Greece from Communist dom­ ination when he sent British troops into that country to help the legal government put down Communist uprisings aimed at overthrowing tho government. So as long as Sir Winston is at the helm, Britian will probably stay in line with the U. S. France,' however, may be a different case. French governments are. un­ stable, don’t last long. There is much appeasement sentiment in France, and many Communists, even in the armed services and in government employment. The Russians hope to split the western powers and wreck the plan for West Gorman rearma­ ment. That and the effort to get Communist China accepted as a fifth major power in future po­ litical conferences is expected to be the line of the Reds in the Berlin parley. Washington is viewing the prospective talks with guarded sentiment. There is no optomism, maybe a slight degree of wishful thinking. The Republican Administration is rapidly approaching decisive days which will seal the fate of the party in the 1954 congress- Because President Eisenhower did not take office until afler Congress was in session this year, ANTI-CATHOLIC? . . . Tre­ mendous crowds streamed into a local theatre here last week to the executive department did not1 see ^le mo^on picture “Martin have time to formulate a complete 'Luther. It opened in Charlotte legislative program. Since Con-' some three or four weeks ago gress adjourned, Republican lead-' ant* there was Quite a bit of talk ers have been working on that. a^ou^ it mostily from members long term program. J t*ie Catholic Church. If “Martin Lu!her" has not yet Key parts of it are of course, appeared in your town, it soon amendmen's to be asked in the will. It’s a good show no doubt Taft-Hartley Act and the new. about it. I know of one couple here agricultural program. Both labor who saw it twice. Nell Battle and farm, elements have shown Lewis whose middle name is .•ome dissatisfaction with the ad- Battle in her News and Observer ministration in' 1953, and if the column last Sunday said: President can nullify those grum-' At this time this picture should blings with a program that at n°t have been produced. Much least wins the support of some le;s in my opinion should it have farmers and workers, he will have been plugged in Protestant done a great deal. churches by Protestant ministers i as it was in Raleigh la^t Sunday Otherwise, it may be rough an(j aSj a movie-thedtre official ?ai,ing for the majority party in tells me, it is being plugged all the congressional elections next over this country in a nation-wide fall. The President is expected to promotion'scheme. Reflect for a give the first clues concerning mpment upon that: All over the his new program when he addres- United States Protestant minis- ses Congress in January. Mean- ters jn Protestant churches are while the program is now rapidly, advertising a motion picture un­ taking final shape after months mistakably hostile to the Roman of intensive study and staff work. Catholic Church ,one which,, it ------------- J sems to me cannot fail to increase The Eisenhower Administration bad feeling toward that Church !s still convinced mpney can be saved in the defense department and present plans call for econo- mies in most of the services—the , . Air Force being the exception. ,hat virtually all pictures coming Unlortunatoly the higher-ups in out of Hollywood are definitely the Army are not happy about Pro-Catholic is no excuse for the proposed cuts in the ground P™duc*ion of a film delta, ely anti-Catholic. Martin Luther is I a good picture . . . but highly | controversial. The Army says is will have to -------------- trim the size of overseas garrisons WHAT IT WAS .. . Andy Grif- if an order to effect manpower fith is a native of Mt. Airy. He economies, is forthcoming. This is Sir Walter Raleigh in the Lost would, of course, upset some U. S. Colony. allies, especially in Europe and He and his wife, Barbara Ed- the Far East, and might cause hot ward Griffith (Eleanor Dare in debate in both the State Depart- Lost Colony) are great entertain­ ment and Congress. j ers. No kidding. Great, She is a Defense Secretary Charles E. native of Troy, North Carolina. Wilson thinks some cuts can be , „ . . . . made, however, and the aim of If -vou havcn t hcard h)S rec- his department remains further PLENTY OF HELP . . . The same day last week that our col­ umn appeared saying there were 500 job vacancies in State offices, the local employment service was on the radio with an announce­ ment to the effect that they had plenty of help available. As a matter of fact, we do have more people wanting work in the general Raleigh area than we have jobs. But, as is of'.en the case„ the pieople needing employment, can’t handle the positions which are open. Business' is good in Raleigh. The papers here each day run '■cores of “help wanted” ads. A. lot of this “job wanted’ talk is: seasonal and from high school and college boys and girls want­ ing afternoon and Saturday em­ ployment. ,1 My folks and I are Protestants. So is Nell Batt’e Lewis. The fact force’s manpower and a ruckus hap developed. economies in 1954-55. The Navy and Marines might have to tighten their belts also. Help Fight TB Football,” then you haven't real­ ly lived. It’s taking the country by storm. It is. Produced* on 45 rpm records by Colonial of Chapel Hill (that’s Orville Campbell, owner of Colonial Press) it tells how this fellow moved into a college town one Saturday af­ ternoon lo put up his tent for a revival meeting. It’s a little af­ ter noon and he gets to this place and gets two hot dogs and a "big orange drank.” He does. He NUMBERS . . . There isn’t much class consciousness around Raleigh. Nobody is much more important than anybody else — un'il the license numbers come out. Then you can vary all the way from 1 down to W-640-397, or worse. The 1954 license numbers have been announced. To many, it’s like a listing of the social regis­ ter in New York City. But to- most Raleigh folks licenso num­ bers mean nothing except a per­ mit to drive the old flivver for another year. In the old days there- was a lot of “putting on the dog” in Raleigh. That doesn’t go much any more. A friend tells me that he went into a hot dog place last week and there sat Secretary of State Thad Eure munching away. How different from 20 years ago when I practically went on tip-toe when walking by the office marked “Secretary of State” in the Capitol. I wonder­ ed then if the time would ever come when I would be able to meet and talk with the Secretary of State. Last week he sat eating hot dogs—all the way—with shop girls, .truck-drivers, Western Un­ ion boys, and folks like you and me. Those license numbers were changed around. Until Gov. Um­ stead -''did some upsetting the fruit basket, congressmen and former Governors were ’way down there. Now Sen. I-Ioey, as former Governor, will receive No. 14. Former Governor Scott, for instance, will receive No. 16, Gov. Cherry getting.,No. 15. As a coincidence, Kerr Scott’s No. 16 is the tame number he cou!d have received when he was Commissioner of Agriculture. However, he would never accept one of those low license numbers until he became Governor and couldn’t help himself. He always said the people didn’t.like to see those 1 o w numbers cruising around. Chances are he won’t ac­ cept No. 16. NO. 116 . . . Why should the president of Ihe N. C. Motor Club get No. 116? No other presidents of organizations get low numbers. This is a long story: and we hope to give it full treatment next week. LEARNING . . . I was in Miami last week with Insurance Comm. Charlie, Gold, his predecessor. Waldo Cheek, Charlie Hastetler, deputy commissioner; and assist­ ants Randy Randolph, Frank At­ kins, Fred Chambers. We were attending the meeting of the Na­ tional Assn. of State Insurance Commissioners, Gold made a good impression, and in general the N, C._ delegation made a valuable contribution to the meeting. They Buy Christmas Seals finds himself shoved by this took an active part. With the crowd into a place where there help of Cheek, Charles Gold is are “two banks of people’ ’and getting off to a good start. He a nice litle green meadow stretch- knows he is up for election next ed out between them. Take it year and Is leaving no stones un- from there. i turned. THURSDAY, DECEMBER 10, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE PAGE THREE'' Fork Mrs. Byerly Sidden spent Sat­ urday in Charlotte and attended the Shrine Bowl game. Mrs. Lloyd Greenway of Mocks­ villc was the week end guest of Mr. and Mrs. E. L, McDanicl. I Miss Lucy Greene of Charlotte spent the week end here with heiv parents, Dr . and Mrs. G. V. Greene. I Mr. and Mrs, C. T. Stevenson] and sons of Raleigh spent Sunday j here, the guests of Mr. and Mrs. Tom Rice. Mrs, Mamie Burton moved from this community Saturday to live with her sister, Mrs. Sallie March who runs a rest home near Win- ston-Salem. ( Bob Massey of Goldsboro was Mason over the week end. Mr. and Mrs. Mitchell Fleming and Mrs. Agie Fleming spent Sunday afternoon in Mooresville with relatives. Mrs. Frank Couch is leaving this week to join her husband in Texas where he is stationed with the Air Force. Mr. and Mrs. Sam Leonard and two daughters, Rhea and Ann, of Tyro and Mrs. E. S. Cope of Spencer were guests of Mrs. Cora Kimmer Sunday afternoon. Jack Couch is leaving this week for Texas. Hazel and Vickie Franks spent Sunday afternoon with Mona Fleming. Mr. and Mrs. W. H. Potts of Reeds spent Sunday afternoon with Mr. and Mrs. W- S. Potts. Use An Enterprise Want Ad t v - 4 5S3T- Christmas Tune is Here What more would your Mother like than a picture of your family group? Pictures of the children, or Mother and Father for the children that have homes of their own.. A PICTURE NOW ... A TREASURE FOR TIME TO COME Pictures made at night by appointment now until Christmas “LET GOD BE TRUE’ By PAUL SIKES The apostle Paul realized the great drawing power of the gos­ pel. “For I am not ashamed of the gospel: for it is the power-of God un'o salvation to everyone that believeth; to the Jew first, and also to the Greek.” (Rom. 1:16). Love is one of the characteristics of the doctrine of Jesus. Lovej- binds a mother to her child, a| husband to his wife, and a child j to its parents. Even the death of j a marlyr is of no avail if not prompted by love. "Though I. speak with the tongues of men and1 of angels, and have not love, I am | become sounding brass, or a clang-, inf cmybal—and if I give my body( to be burned, but have not Jove, iti profiteth me nothing.” (I Cor. 13: 1, 3.) Man should first turn his love to God. On one occasion Christ was asked which commandment was the greatest. Listen to his ans­ wer, “Thou shalt love the Lord thy God with all thy heart, and | with all thy soul, and with all , thy mind, and with all thy [ ; strength.” (Mark 12:30). This love toward God will cause us to j obey him. “For thin is the love of. God, that we keep His command-, ments.” (I John 5:3). j As Christians we must also loVe J our neighbors. “Thou shalt lovej thy neighbor as thyself.” (Mark! 12:31). This type of love will give' us gn opportunity to practice the golden rule. “And as you would that man rhould do to you, do ye also unto them likewise.” (Luke 6:31). ; The Love which is so prevalent in the gospel of Christ seeks to unite brethren in the church and encourages Christians to seek and, attempt to save lost souls. Jesus came into tis world “to save sinn-, ers.” (I Tim. 1:15). Today we must have this spirit of Christ which j prompted soldiers of the crossj over 1900 years ago to go “about preaching the word." (Acts 8:4). The great power of love as. taught by Christ causes a Christ-1 ian to love his enemies. 'Thus an! enemy may become a friend. Paul; encourages such behavior in writ- j ing to the Christians at Rome, j “But if thine enemy hunger, feed j Turkey Fool Rock Springs W. M. S. met at the home of Miss Duo Shaw Sat­ urday night. Mrs. J. O. Bumgarner is visit­ ing her daughters, Mrs. George Shinn and Mr. Shinn in Char­ lotte. Mrs. Wright Shoemaker of Union Grove, Mrs. C. C. Trivette and son, Charles, of Harmony, spent Wednesday with Mrs. R. C. Fostfcr. Mr. and Mrs. M. O. Renegar visited Mrs. Renegar’s mother, near Lone Hickory Sunday af­ ternoon. Mr. and Mrs. James Stroud and children visited Mr. and. Mrs. Vir­ gil Foster Saturday. F ii n PicturesFramesCamerasFilm BooksChildren BooksBiblesPlaques Phone 360 137 Salisbury StreetMocksville, N. C. e r a ! s Mrs. Lessie Swink, 66 Mrs. Lessie Dula Swink, 66 died at 1:30 p.m. Monday at her home a* Cooleemee. She had been in declining health for several years. Mrs. Swink was born in Davie County June 4, 1887, daughter of Sidney A. and Jane Foster Dula. She spent her entire life in Davie County and had resided in Cool­ eemee for 50 years. She was a charter member of Cooleemee Methodist Church. She w a s married to R. L. Swink in 1908, He died in 1932. Surviving are two sisters, Miss-1 es Janie and Minnie Dula, both of the home. Funeral services were held at 3:30 p.m. Wednesday at Coolee­ mee Methodist Church. The Rev. Harold Aus'in officiated. Burial was in Joppa Cemetery. State College Alumni Hold Dinner Meeting A State College Alumni dinner meeting was held Tuesday even­ ing in the Rotary Hut. A three course dinner was served prior to the meeting by Mrs. C. H. Tomlinson and Mrs. S. M. Call. The linen covered tables held arrangements of fes­ tive greens, red berrier and glow­ ing red candies. The mienu consisted of turkey, gravy, dressing ,rice, green peas, sweet potatoes In orange cups, cranberry salad, pickles, buttered hot rolls, strawberry short cake and coffee. L Can You Afford to Pay *AN AUTOMOBILE ACCIDENT DAMAGE AWARD UP TO $ 1 1 , 0 0 0 ? If You Can’t I°“.s'a"d to los® your operatorslicense, your cash or securities, your home, your savings, your job, and your automobile under the new North Carolina Motor Vehicle Safety Responsibility Act, effective January 1, 1954, unless you can comply with the law. WE WILL BE GLAD TO HELP YOU BECOME PROPERLY INSUREDALL LIABILITY POLICIES ISSUED BY THIS AGENCY FULLY COMPLY WITH THE NEW N. C. STATE LAW. LOOK FOR THE SIGNATURE OF J. E. DURHAM, LOCAL REPRESENTATIVE, ON YOUR POLICY. Mocksville Insurance Agency ---Second Floor Sanford Building- Telephone 397 (Day); 246-W (Night)Mocksville, N. C. him; if he Ihrist, give him drink:; for is so doing thou shalt heap,' coals of fire upon his head.” (Rom. j 12:30). Some day faith will be lost in sight, hope will become real­ ity, but love, the greatest of these, will continue through eternity. adv. JERICHO CHURCH OF CHRIST Mr. and Mrs. Delano Loflin of Route 2, a daughter, on Dec. 5, at Lula Conrads Hospital, Yad­ kinville. Mr. and Mrs. Harold Lee Carter of Route 2, a son, Dec. 7, at Lula Conrad Hoots Hospital. Mr. and Mrs. Bill Peoples of Rt. 4, a son, William, Jr., on Dec. 4, at Rowan Memorial Hospital youAbout Kieer hear 1 Re-opening Saturday December 19?Here’s your chance to win a basket of groceries absolutely §1 free. All you do is go out and register, anytime. Just sign ^ your name and drop it in the box. |15 BASKETS OF GROCERIES WLL BE GIVEN AWAY ON THE fDATE SHOWN ABOVE gDrawings .will be held at three different times on Saturday, Dec. M 19. Five baskets will be given away at the 4 p.m. drawing, 5 baskets W will be given away at the 5 p.m. drawing, and 5 baskets will be given g| away at the 6 p.m. drawing. You will be delighted at the easy shopping at the new Kiger remodel- || ed store. Convenient locations, new departments added, and a general “New Look” will greet you. But don’t wait. Come in and register now. |r Kig er Self Service Grocery For Christmas gifts that will be appreciated daily year after year, give something for the home! A thoughtfully selected gift from our wonderful selection is the nicest possible remembrance for both your family and friends. Seven-Drawer KNEEHOLE DESK $49.95 HASS from O C K S $5.95 TABLE Covered in long - wearing washable plastic. Choice of colors.Finished in rich mahogany, g A gift for the family! jjf Brass Fireplace Fixtures |Fire Screen ....... $14.95| Electric Mixer With Juicer CARD $5.95 Chairs, $6.95 each .Sturdy folding table with steel legs and framing. Hamilton Beach 'gtg‘6tste>6tcisiei3:ig!sie<c!e<a<si€te,sis,eieie!s<e|sl2>e<«*ieI CLOTHES HAMPER if| As low as $9.95Andirons ......... $14,955} $42.95 beauty for “Mom” aPearl-wick hampers for year around use. The practical gift fa A gift of lasting charm and vji An ideal work-saving gift » n y*saaa»aSl»aSiaaSl9!3lS&3j3l5ia».aaa3saa3iai'i3:aa»»Siaaaasaaa:aa»aa3:a»aaS!»aftSiaa»a3;a»2iaSia)»»2«3iaaa3l&ia2i2iSi3.a2iS!2;K *r a'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa %8 See our selection of— £ 8?Q Occasional Chairs (all types) | |© Lamps (Floor and table, all styles) g g© All Types of Tables | |© Full Line of Electrical Appliances % g K[tgtgtgtatetcte(gictetg>.£tcts'g’.£% tgtgtst;!e!e'£'etgtet£tete<£!£tsg'i£’< ‘@tsts>G!C'£>£>4 ALANE C E D A R C H E S i y - ' f ; ]. YMahogany DROP-LEAF TABLE $39.95Mahogany Duncan Phyfe style | table. Opens large g enough to seat six. § finished g b ’ $49.95 Stunning modern design with beautiful blond oak finish—the surest way to her heart on Christmas morning! MAGAZINE RACK $5.95 Mahogany or pine finish. A useful Gift for the home! Hendricks 6 * Merrell Furniture Company North Main Street Mocksville, N. C.PHONE 342 MOCKSVILLE, N. C. PAGE FOUR THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 10, 1953 1 i iI% ‘A%I G U sU & tm a l SPECIALS VISIT U S—SEE WHAT YOU S A V E g -s y A y| Pet or Carnation CAN g | Milk................12V2cI —LIMIT 6 CANS TO A CUSTOMER— CRISCO.................3 lb. can, 87c |8 FAB .................... large size, 29c I JK$I 1K % RINSO ..................large size, 27c | v SUGAR....................5 lbs., 49c AH Popular Brands Cigarettes per ctn. $1.69tax incl. Macedonia Luden’s CHOCOLATE DROPS.....25c lb. PECANS........................25c lb. S Assortment of:—| DOLLS AND CHRISTMAS TOYS *% CHRISTMAS CANDIES, FRUITS & NUTS § North End Cash Store I —OTIS HENDRIX, Proprietor- icoi N. Main St.Mocksville, N: C. % ..'eicteieictetctetete'cicictctctstgic'eistgts'g'g'eigtgte'e'g'a'sigsg'e'ets'e'eig'stsxtcte'eis'eie The Moravian Auxiliary will meet with Mrs. Rosa Riddle, Yad­ kin Valley Road, Thursday night at 7:30 o’clock. Mrs. Kate Riddle :s joint hostess. Christmas gifts •vill be exchanged at this meet­ ing. The various Sunday schools of the community will render their Christmas • program as follows: Bethlehem M. A., Tuesday night. Dec. 22; Dulins M. E., Wednes­ day night, Dec. 23; Smith Grove "VT. E. and Macedonia Moravian, Thursday night, Dec. 24; Yad- Vin Vailey Baptist, Friday night, Dec. 25. These programs should be well attended, providing the weather and health conditions are favorable. Pvt. Johnnie Williams, son of Mr. and Mrs. Spence Wiliams, wri es from South Korea that he finds the country in a terrible war torn condition. He enjoys good heal'h and only wishes that he could be home for Christmas. Mrs. Frank Sheeks is still suf­ fering from bruises from the fall while leaving Elbaville M. E. Church, during the funeral of W. G. Ratledge. Mr. and Mrs. Joe Howard quiet­ ly celebrated their 50th wedding 'inniversary, Wednesday, at their j home, wi'h only their children and a few friends calling. The Rev. Mr. Bruner conducted services Sunday afternoon at the Lynn Haven Nursing Home, in Mocksville, The Community Union Services of the Dulin’s Methodist Charge, Macedonia Moravion was held at Yadkin Valley Baptist Church Sunday night, with the church comfortably filled, in spite of the down pour of much needed rain ■>nd the questionable roads. The Rev. Alvis Cheshire was in charge of Ihe services. The Rev. G. E. Smith read the scripture and of- fored prayer. The Rev. Mr. Bru­ ner brought the message. A mixed group of singers from Macedonia and Bethlehem churches sang several numbers with Leo Dunn leading, ^he Yadkin Valley Bap­ tist Choir and quartet sang sev­ eral numbers. The next union service will be held at Bethlehem M. E. Church, the fourth Sunday night in January, with the Rev. Mr. Cheshire delivering the ser­ mon. Richard Foster, son of Mr. and Mrs. ,R. Paul Foster, is on fur­ lough and is visting his parents. He is in tho Air Force school at Fort Benning, Ga. Miss Naomi Riddle, student nurse at the Baptist Hospital in Winston-Salem, spent the week end with her parents,, Mr. and Mrs. O'car Riddle. The Rev. Mr. Bruner and Mr. John Bowden were entertained at dinner Tuesday at the home of Grover Bowden and sisters, Misses Lola and Lettie. t Many from this community at­ tended the funeral service Mon­ day afternoon for 10 months old Johnny Myers, son of Mr. and Mrs. John Myers, conducted from Mock’s M. E. Church. Then again the funeral services for Edward Holder, 76, Tuesday afternoon, conducted from the home of his daughter, Mrs. Clyde Woods, Ad­ vance Cross Roads. Colored News Living Madonnas To Be Presented at DCTS Sunday Our feature of Christmas at Davie County Training School will be. a presentation of the “Living Madonnas” in the school gymtorium at 5 p.m., Dec. 13. Paintings are being prepared by art students of various class­ es under the supervision of Miss .rma C. Burke, member of the senior class. Costumes and prop­ erties are designed by Miss A. A. White and Mrs. J. T. Steele. The construction of scenery is super­ vised by T. S. Holman. The light­ ing . is supervised by J. A. Ful- more. The Glee Club, under the di­ rection of Mrs. A. Y. Bovian, will furnish the music, and Miss A. A.'White will be reader. Forming the living tableaux are the following students: Nellie Holman, Clessie Mclvar, Mary ■ Hall, Beatrice Foster, Christine : Dulin, Sadie L, Dulin, Nannie P. Frost, Novella Williams, Marilyn Foster, Toni Dalton, Patricia Dal­ ton, Carolyn Dillard, Dianne Ta­ tum, Valeria Fowler, Eleanor Issac, Patsy Johnson, John Nich­ olson, Rondell Smoot, Lester Stu- devant, Chester Studevant and Alex Mason. Mrs. M. D. Hudson will direct the formation of the tableaux. Pre-Christmas Clearance Sale —ALL MATERIALS IN THE STORE ON SALE— THIS SALE IS UNDERWAY NOW—SO HURRY Big Reductions Come Early SAVE NOW SPECIA L—THIS SALE ONLY .QUALITY NYLON HOSE 60 gauge—15 denier ................ EACH SATURDAY from now until Christmas we x I cr. will give 3 YARDS OF LORETTE to some lucky person. Register now for your chance on this miracle fabric. 79c pr Cone’s finest CORDUROY Regular $1.19 SALE PRICE, 98c many colors Nationaly advertised “LORETTE” 55% rayon, 45% wool. Reg. $3.29. SALE PRICE $1.98 60 inches wide S?%%K Dan River GINGHAMS15% OFF Sew and Save Twill-Back VELVETEEN Regular $2.98 SALE PRICE $2.49Spot resistantwater repellent PRINTS ■ OUTING - SUEDE - FLANNEL PLISSE CLOTH & BROADCLOTH.Regular 39c yd.3 YDS. for $1 25% OFF ON EVERY ITEM ON THE Remnant Counter !cte>e’«tc'e<c!e>e>e<cte>«te>c>e!e « |ci«c‘«!c‘e'«eie!e'c<c>e!c‘c « te'etc««!€'e‘c'c>e!c!ctc!cte«c'e<ctsictctctcte'e«!c'ctc>c!ctc«ti DON’T FORGET TO SHOP AT BIG SAVINGS THIS WEEK AT T he Remnant Shop 1x/i Q <1 £ w Yadkinville Road Mocksville, N. C. AND WHOLESALING USED CARS Inc.Pennington Chevrolet Co., USED CARS AND TRUCKS Below Auction Prices • Warning • We positively refuse to sell any of these cars to outside dealers. We want the retail buyers to take advantage of the $150 to $400 profit that would be made by the outside used car dealer in reselling these cars. About this time of the year we accumulate a big stock of used cars In the past we have sold part of our used cai's to used car dealers outside of our community. If we are going to sacrifice prices ... as we are going to do now .. . we prefer to have these savings go to our many, friends who have dealt with us over the past years. We’re therefore offering our entire used car stock at whole­sale to the retail trade. No gimmicks, no prizes and we don’t have to sell 25 cars in so many days . . . we’re simply wholesaling our stock to our retail trade. • Terms • Use the GMAC Easy Payment Plan. No Monthly payments until January 20, 1954. True your car in most cases will make the down payment. Special and irregular deals on some cars. IT’S NOT A SALE UNLESS THE PRICES ARE UNDER THE MARKET SALE Thur. Fri. Sat. OUR POLICY—The policy of Pennington Chevrolet Co., Inc., is that every car of­ fered for sale at this big three day wliole- saleing will be fairly and accurately repre­ sented to the public. SALE Dec. 10,11,12 THESE CARS ALL LOCALLY OWNED AND TRADED IN ON NEW CHEVROLETS Look at these Wholesale Prices Make Year Stock No. Was NOWPLYMOUTH 1948 254A $895 $445CHEVROLET 1949 281 $945 $595CHEVROLET 1948 243A $795 $495 Make CHEVROLETCHEVROLETNASH Year Stock No. Was1950 19461951 288286278 $1045$595$995 NOW Make$695 PLYMOUTH$345 CHEV. P. U.$645 DODGE 1% Year Stock No. Was NOW 1947 19511948 267275283 $795 $495 $945 $645 $495—$295 E very used car on our lot will have rock bottom wholesale price marked on windshield P en n in gton C h ev rolet C om p a n y PHONE 156 MOCKSVILLE, N. C. THURSDAY, DECEMBER 10, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE PAGE FIVE Farm and Home News —PROM XIIE COUNTY AND HOME AGENT’S OFFICE— Plan An Al!-Fullct Flock In 1954 "With Santa Claus on his way ••and the New Year just around the ■corncr, it might be a good time during the month of December. By placing your order early you should be able to get the type of chicks when you want them. Be sure to specify production bred to think amout your poultry pro- chicks for layers since breeding igram while you are sitting around ’ is the main key to a profitable the fire on these cool days. | poultry flock. Remember that the Your chick order should be flocks that lay 200 or more eggs placed with your hatcheryman per bird are the ones that pay. | S 1 Loaded with Stqle! ! 3 » M M | Set your sights on 1 Gun Classics Plasted*, 'AMOK, CUFF LINKS and TIE BARSThese exciting new accessories are perfect reproductions of historic old firearms—completely unique. Four distinctive hand-wrought sets. 9. English Ovtr and Under...1790 j i j 9 5how to make buy M ORE S H IR T W EAR- I I 8 SUPERFORT with guar ant ecd'iiiTfianeClothCollarand Cuffs Soft, supple; yet strong Airplane Cloth,Collar and Cuffs are almost in­ destructible. In fact, we’ll give you a new shirt free if collar or cuffs wear out before the thirt body (a magnif­icent, high counbroadcloth in its own right). So do ycur budget proud and stock up now. Almost any collar style your heart desires. ' only * 3 9 5 SALISBURY'S STORE FOR MEW*221 S. St. SALISBURY, N. C. -tact.d In itunnlnf “gun Itwtltf boi. One way to keep the production high is tor poultry raisers to keep an all pullet flock.' Pullets lay more eggs than hens, thereby re­ quiring less feod and produce each dozen eggs. Also, early hatched pullets will be laying when egg prices are the highest, Old hens usually molt and got a “new coat of feathers” during the high egg price period. Ac­ cording to recent research work pullets requiring 39.8 per cent less feed to produce a dozen eggs then they did in their second year of lay. Also, the old hens laid thinner shelled eggs wihch result­ ed in 158 per cent more broken eggs than for the pullet year. The pullets produced thicker egg whites than the old hens. Another reason tor keeping an all-pullet flock would be that usually the mortali'y is lower than for old hens or a flock of mixed ages. Some few producers se’ect fheir best layers and hold them over for another year, but usual­ ly the production is about 25 or 30 eggs less for the second year of laying. In most cases a producer is better off by starting with an all- pullet flock in the laying house each summer or early fall. So, p'an your poultry program to slart sufficient number of chicksl in January, February or March for an all-pullet flock six months later. Egg Quality Is Important Whether you sell to a grading station, grocery store, housewife, restaurant or hucksters they all want clean eggs with good in'.er- ior quality. In a survey of stores in West Virginia they found that 16.2 per cent of the eggs were either dirty, stained or cracked. Dirty and stained eggs are not permitted in any of our grades of eggs. Most of the dirty and stain­ ed eggs can be prevented and the number of cracked ones can be reduced. A poultryman can produce 95 to 99 per cent clean eggs by: providing clean deep floor litter, keeping the roosts wired in, providing plenty of nests with clean nesting materials, and collecting the eggs four to five times each day. December Reminders 1. Check for lice and mi‘es. Hens that were free of lice laid 11 per cent more eggs than hens that were lousy, according to re­ search in Alabama.' 2. Provide deep floor litter and keep clean litter in all nests. 3. Cull all “Star boarders” and any showing disease symptoms. 4. Play Santa Claus to your flock by provding water warm­ ers. Drinking water that is froz­ en for just a half day can lower production. 5. Keep birds comfortable on cold days. Use curtains on open fronts. 6. Guard against colds in the flock: Moisten with feeding (cod liver., oil at the first signs of a co!d. 7. Use lights, pellets or wet mash to stimula'e production. 8. Provide and use a disposal pit. 9. Get rid of rats. The feed they eat return no profit. 10. Collect eggs often as they freeze and crack attemperatures below 20 degres F. 11. Offer, clean, high quality eggs to fresh egg customers. 12. Keep records. They tell the story of your flock. Take inven­ tory at the end of this month. Farmington P.-T. A. The regular monthly PTA meet­ ing of the Farmington school will be held iThurnday, Dec. 10, at 7:30 in the school auditorium. After a brief business session a program of the Christmas story, told in scripture, tableau, and song will be presented by the Music comittee: Mrs. Nell Lash­ ley, Miss Betty J. Mabe, and Miss Belle Smith, chairman. Announcement Please do not bring in any more beef until after Jan. 1st. We have all we can handle between now and that time. We will close Dec. 24, 25 and 26, for the Christmas holidays. However, we do have space for hogs, so bring in your hog meat, we can handle it right now. Only two more days for dressing chickens—Dec. 10 and Dec. 17. We wish to thank' all our friends and customers for their cooperation and for their business. We sincerely appreciate it. Davie Freezer Locker ,5 I GIVE . . . I jj Lovely Nylon Lingerie * THE PERFECT GIFT fromMOTHER AND DAUGHTER FASHIONSin Winston-Salem We’ve a glamorous collection of beautiful’ nylon tricot undies—gowns from $5.98, panties from $1. Petticoats from $2.98 and slips from $2.98.All purchases boxed and gift wrapped free FASHIONS Corner Liberty and Third Streets in Winston-Salem Free Pine Seedlings For | 4-H C’ub Members j 4-H Club members may receive, I without charge, from 500 to 5,000 ■ ('hortleaf pine reedlinKs ai/ain this year. The wood using industries of North Carolina are paying for these pines. So far, three D^vie County 4-H Club members, Earl , Seamon, David Jones and Alvin Whitnker, have ordered 5,000 seedlings. These seedlings are one vear old and are in excellent condi ion for planting. Those th«it have idle or eroded land can nut in to work for you. Anv club member can realize a good income from trees planted now during his or her life­ time. These trees should be order­ ed this month as the supply is limited. January and February, when the ground is not -frozen, U the best time' to set trees. No land preparation is needed for the-e trees. They should be set six feet apart in seven foot rows and this will require about 1000 seedlings per acre. Tobacco Marketing Cards Farmers are urged by O. E. Driver, Chairman of the Davie County ASC office to return their marketing cards to the ofiice as soon as they finish selling to­ bacco. IT PAYS TO ADVERTISE cook if cool co o k it quick cook it on the s When building or re­ modeling, plan a cir­ cuit for your outdoor electric living. T h e outlet can be adequate, safe, and invisible — built into the wall of terrace, p o r c h or patio. Have fun while you cook. Let folks gather round to watch and whiff. 0 ‘ . Your guests will talk for days about your good on-the-spot cooking. Your fanily wil ask for more luscious, outdoor meals, with Mother having fun while she cooks. Just another way Dependable/ Low-Priced Electric Service takes the irk out of work— gives you more hours to share fun with your friends and your family. D TJK JEb P O W E R C O M P A N Y PAGE SIX THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 10, 1953 FHS Echos By SHERRILL BRINKLEY & EMMA SUE ALLEN The girls took the lead in the W o m e n o f T h e CllU l’ch ifrst quarter and were never in trouble. Emma Sue Allen and Jo In s ta ll O ffice r s A t Ann Boles had 10 points each and 0 ____•« *___■ • „ ' Dorothy Reavis had six to lead SlippS F M e e till the Farmington team. | The women of the Mocksville Two wins and one loss are the! ^The boys racked up a six point Piesbyteiian Church hold their records of the basketball teams 'ead in ihe first few minutes, December meeting jointly with after their wins over Cleveland' but Cleveland had closed the gap the four circle? on Monday even? cn Tuesday night of last week.'to 1 point by half-time. F. H. S. Inn. Doc. 7 n't 7:30 in the church The girls took their game 29 to llac* another 6 point lead by the hut. Mr*. D. J. Mando, chair- 20; and the boys theirs, 41 to 38. end ol the third quarter, hwt w ?n of Church Extension, Mrs. ________________________’_________Cleveland kept hacking into this '•JnV'n Durham and Miss Willie lead until the final gun. Johnny Miller of the Social Activities Beg?r with 10 and Francis Ellis Committee, were in charge of the with 13 led Ihe scoring atttack. buffet supper served to 51 wo- On Friday night of last week n' pn. The hut was decorated wi'h Stanfield’s men traveled to Hanes Chri-tmas candles and berries. High to play their strong Junior The president, Mrs. P. C. Grubb, j Varsity team. This game ended in presided over the meeting which j 33 'o 33. Johnny Boger had 13 and Bill Walker and Francis EHis had 8 each to lead, the scoring. W. S. C. S. Have Yule Meeting The Woman's Society of Christ­ ian Service met Monday evening in the Ladies' Parlor of the First Me'hodist Church. Red berries, festive greens and red candles decorated the parlor for the occasion. This Christmas - GIVE THE FINEST... B uiova The Finest Watch in the World I op*nnd with t.ie singing of ",Tov To The World.” Miss Sarah Gaither, the historian, read the GODDESS OF TIME 17 Jewels 2 diamonds 21 liweli vfaoslM tul FOSTERS WATCH SHOP The Square - Mocksvi'le The meeting opened with soft music played by Mrs. G. A. Hart- ' man. The Afternoon Circle members, led by Mrs. W. Q, Grigg, conduct­ ed the Christmas, program and Mrs.' E, L. Short, president, pre­ sided at the business session. “Away In A Manger” was sung at the conclusion on the program. Tweny-three members attended. Christmas Vespers To Be at Misenheimer . The annual Christmas Vespers at Pfeiffer Junior College, Mis­ enheimer, will be held Sunday, December 13. The program will begin at 7 p.m., and will feature voice chapel choir co enioved the came verv u * • • ■ ducted by ^^ilbur 1. Serivnor,enjoyed game very ld m.s-ions, Miss Sarah Gai- Dil.ec or of Music. Miss Emily ther; chwrman of -.pintual growth, Lynn Kel^ of Mt Holl is the Mrs. Bill McClamrock; historian, I student tat and: acc0mpanist. Glass backboards seemed to cau-e history of our church work for j our boys a great deal of trouble, the past year. ; I Mrs. Knox Johnstone installed | The star ers o fthe Girls’ team, ^ these women for office for' the ,EnVm<i Sue Allen Jo Ann Boles, I ypar«, • 1954 anrJ 1955. preside^ • ’V.rothv Reavis, Mary Lillian Pil- Mrs. W . p. Robinson; treasurer, cher. Bessie Seats and Rachel jy[rs, Ted Junker.: chairman church t.nr'u-ton, went to Hanes gym extension,-Mrs. Gaither Sanford; Saturday night to see Hanes Ho- chairman annuities and pensions, | fVl„ dn T b Z and At’anta Peaches play‘ Mrs. D. C. Rankin; chairman of much. See Our Complete line of GIFT SELECTION -Use Our LAY AWAY PLAN- Farm'ngton traveled to Cleve- l-'nrl to give two return games Tuesday night. F. H. S. has changed 'he name of Cloudbusters to Blue Devils. December 18 is to be a great day here at Farmington. We plan to have a home-coming in which a queen will be crowned. All for­ mer basketball players arid stu­ dents are invited to attend. "Grandpa says the way to get a lot oj good things jo r Christmas is to put plenty of Smith-Douglass Fertilizer on the ground!” Provide for your next Christmas by applying Smith-Douglass Fertilizer to all your crops at the recommended rates. $1 worth of high quality Smith-Douglass Fertilizer results in average increased yield worth more than $5! High-quality S-D Fertilizer of the right grade and in the right amountreduces unit production cost by increasing yiel< Sm’th-Dooglass Fertilizers pr«Id and quality per acre. Let the nearby S«D Fertilizer rep­resentative help you keep your income up! Listen toDEBNAM VIEWS THE NEWS’ 12:45-1.00 dally own a There is one priced to fit your budget. Easy terms—liberal trade- in. Come in and see a demonstration of the extra-fast, extra-effi­ cient washing action that has built the Maytag reputation. THE M AYTAG M A STER . Finest Maying overl Hugo, alum inum tub holds m ore; k o o p s w a tor-"' hot longer. $ 1 8 9 . 9 5 Mrs. Turner Ammons. Those be- <r;nning their second year in of­ fice are: vice president, Mrs. Ce­ cil Morris: secretary, Mrs. Dexter Bverly; stewardship, Mirs. Sam Waters; Christian education, Mrs. Bob James, general fund agencies, Mrs. Mae Evans. ' Deanna Silverdis sang, “Seal Us O Holy Spirit.” The incoming president, Mrs. W. F. Robinson,’ announced the new circle chairman and co- chairmen for 1954. They are: Circle 1—Mrs. Knox Johnstone, Mrs. Oscar Beaver. Circle 2—Mrs. Cecil Morris, Mrs. Paul Blackwelder. Circle 3—Miss Carroll John­ stone, Miss Nell Holthouser. Circle 4—Jane Robinson, Mar­ tha Rose Waters. Adult advisor for Circle 4, the girls' circle, is Mrs. Charles Phillips, Sr. The annual meeting was clos­ ed with prayer by Mrs. Paul Blackwelder. Sheffield Mr. and Mrs. Lonnie Gaither and daughter, Patty, visited Mrs. Lula Campbell, Sunday. Mr .and Mrs. Wade Wright spent the week end with Mr. and Mrs. Venson Wright'bf High Point. Paul Back and Margelene Hol­ ton visited Miss Molly Ann Rich­ ardson Sunday. Misses Dorothy Salmons and Judy Wright spent the week end with Mr. and Mrs. Junior Wright of East Bend. Mr. and Mrs. Harding Richard­ son of Cooleemee visited his par­ ents, Mr. and Mrs. B. C. Richard­ son. Sunday. Mr. and Mrs. Darnell. Cleary visited Rev. and Mrs. W .C. Bulla Sunday. THE M AYTAG CHIEFTAIN, Amer. genuine Muytag inovory reapcct. THE M A Y T A G CO M M AN D ER , rith large Hqmirn.pocccUiinJulumri_ _ fast ofllcieot Gyrafoatu ** action.$129.95 $152.45« t ■ fi | C. X Angell Appliance Co. s Phone GO On The Square Farmington | Mrs. Queen Bess Kennen of Boonville spent the week end at home. Miss Be’te Montgomery, stu­ dent nurse in the Charlote Hos­ pital, is recovering from an ap­ pendectomy last week. Mrs. W. A. Taylor- who has been with her mother, Mrs. W. F. Walker, in Winston-Salem for several weeks is at home this week. Mr. and Mrs. Kenneth Taylor have moved from Fit Branch j Farm and are now living in North Farmington. Mrs. B. C. Brock Jr. and daugh­ ters, Carolyn and Pat, returned home Sunday from an extended visit with Mrs. Brock’s father, W. Ii. Rankins of River Edge, N. J. Lt. James M. Brock, who has been at Smoky Hill Air Base, Salina Kansas, for the past year, is at home on a 15 day leave. Dr. and Mrs. Basil Tucker and •laughter of Leaksville were Sun­ day guests of Mrs. Tucker's par­ ents, Mr. and Mrs. B. C. Brock, Sr. Fellowship Supper Given Tuesday Ni^ht Circle 3 of the W S. C. S. of •lie First Methodist Church serv­ ed a.turkey dinner Tuesday night to the men of the church. A light­ ed Christmas tree, berries, ever­ greens and red candles decorat­ ed the Fellowship Hall for the occasion. Approximately GO men attend­ 'd the fellowship dinner. Miss Carolyn Smith of Mocks­ ville is a member of the college choir. si IT PAYS TO ADVERTISE Gel low cost Farm Bureau auto insurance — save up to 25%. Standard, nonassess­ able policy . . . quick, friend­ ly claims service. Second largest mutual auto insurer in U. S. FOR INFORMATION, PHONE A. E. HENDRIX Office Knox Bldg. Depot Street and Lexington Road. Phone 328-W - Mocksville, N. C. FARM BUREAU MUTUAL AUTOMOBILE INSURANCE (0. . COLUMBUS, OHIO Com ing —RINGS "—TIE SETS —MASONIC ITEMS —DINNER RINGS —CHINA—Rhinestone NECKLACES —ELECTRIC RAZORS —FOUNTAIN PENS (Shaeffer) —PEN & PENCIL SETS GIFT SUGGESTIONS-----—BILLFOLDS —CUFF LINKS—WATCH CHAINS—WATCHES—EARRINGS -STRETCH BANDS -DIAMONDS -SILVER —LAPEL PINS —SHEAFFER “SNORKEL”—RONSON LIGHTERS —BRACELET & LOCKET SETS —NECKLACE & EARRING SETS C. J. Angell Jewelry Phone 60 Mocksville, N. C. Take advantage of the many fine H)me Furnishing GIFTS ... NOW At SHEFFIELD FURMITURE COMPANY SOFA BEDStapestry, $44.50values to 69.50 2 - Tone PlasticNOW $69.50Values to $89.95 8 Platform ROCKERSplastic and fabric Knee Hole DESKS Mahogany, $49.50 Modern Bedroom Suites, limed-oak and sea- foam mahogany. 18th Century Bed Room Suites. Poster Bed Room Suites, starting as low as.........................$79.50 Values to $39.95 NOW .... $27.50 Values to $59.95 NOW .... $47.50 mCavalier CEDAR CHESTS -Formica Tops Finished in walnut,blonde waterfall andmodern limed - oak.15% to 20% DiscountsTTT-----------1 DINETTE SUITES-Linoleum Rugs »9 x 12 ...... $7.95g Plastic covered chairs, from .......$49.50 y ELECTRIC APPLIANCES § HOTPOINT EQUIPMENT GE RADIOS — CLOCKS GE IRONS — STEAM IRONSMixers —- Toasters — Percolators & DEEP FREEZERS fJff OPEN EVERY NIGHT ’TILL 9 O’CLOCK. SATURDAY ’Till 10 p.m. FROM NOW UNTIL CHRISTMAS STOVES — REFRIGERATORS Brides To Be — Brides of Today — Brides of Yesterday: SELECTION BEFORE YOU BUY!SEE OUR PENNINGTON CHEVROLET CO., Inc. Phone 15G Mocksville, N. C. S H E F F IE L D F U R N IT U R E C O . Route 1, Mocksville At Sheffield THURSDAY, DECEMBER 10, 1953_____ iV V V V V .N % V % \% W A W .,.V .V W .W .,. W . V . W . ,A W V . W THE MOCKSVILLE (N. C.) ENTERPRISE PAGE SEVEN r A W .W .V .V .V .V i V - W A W .V .V .W .V .V .W .V .W .W .W Harry Osborne, Jr. ,and Rob­ ert Latham spent Saturday and Sunday at State College, Raleigh. Week end guests of Mrs. Grady 'Dunn, who is visiting her parents, Mr. and Mrs. J. C. Collette, on the Yadkinville Road, were Miss 'Benrie Levesque ot Maine; Char­ lie Geis'er of Tulsa, Okla., and Bob Sprinkle and Mr. and Mrs. "R. L. Sprinkle of Winston-Salem. Mr. and Mrs. H. J. Cherry, Jr., -and daughter, Judy, of Salisbury •spent the week end with Mr. and Mrs. R. Duke Tutterow and son. Mr. and Mrs. G. N. Cook left this week for .their winter home in Homestead, Fla. Mrs. J. S. Sano.frd, Mrs. A. M. Kimbrough, Jr., Miss Mary Mc­ Guire, Gaither Sanford and Mac ' Kimbrough saw “The Robe” in ' Winston-Salem Sunday afternoon. Guy Hartman, Clemson Coll­ ege student, spent the week end •with his parents, Mr. and Mrs. G. A. Hartman. O. K. Pope, Aubrey Merrell, • Gilmer Brewer and John McDan­ iel left Monday for Spartanburg, 'S.‘ C., to attend a dealer’s show- • ing of 1954 Chevrolet passenger ■ cars. The cars will be shown to the public, on Dec. 18. Miss Evona York, accompanied by her father, James York, went • to Raleigh for the Folk Lore So­ ciety meeting Friday. They were • the guer.ts of Mr. and Mrs. W. C. 'Y ork in Fuquay Springs Thurs- • day night. Rev. M. T. Hipps, District Su­ perintendent of the Thomasville district, Methodist Church, deliv- and son spent Sunday afternoon in Woodleaf, the guests of Mr, and Mrs. D. H. Penniger. Mrs. A. M. Kimbrough, Jr., Mrs. G. N. Ward and Mrs. Mar­ garet A. LeGrand spent last Wed­ nesday in Winston-Salem. Miss Clara Belle LeGrand of Winston-Salem spent the week end at home with her parents, Mr. and Mrs. J. P. LeGrand, Mi'-s LeGrand and her father bird hunted Saturday afternoon. Mr. and Mrs. E. C* Dickinson and children, Mr. and Mrs. Knox Johns'one, Hanes' Yates and Mr. and Mrs. P. J. Johnson attended the dedication of the Veterans Administration ' Hospital Sunday afternoon in Salisbury. Miss Sue Brown o f Lenoir spent the week end here with her parents, Mr. and Mrs; P. G. Brown. Mr. and Mrs. Paul Blackwelder and daughter, Louise, spent Fri­ day and Sa'urday in Charlotte, the guests of Mr. and Mrs. George Kuykendall and Mrs. E. P. Brad­ ley. Mrs, E. M. Avette returned Monday from High Point, where she spent the week end with rel­ atives there and at Gold Hill. • Saturday afternoon visitors of B. C. Clement were Mrs. J. T. Scott, Mrs. H. G. Moore and Miss Susie LeGrand of Winston-Salem, i Mrs. A. R. Tomlinson has been I indisposed for several weeks at' her home on Wilkesboro Street. Oscar McClamrock visited his brother, Charlie, Saturday at Da- ered the sermon at the First! vis Hospital, Statesvilie. Mr. JiTc- Methodist Church Sunday night. I Clamrock is slowly improving M r.'and Mrs. Frank Miller i from a recent automobile wreck. Seven H. D. Clubs To Have Yule Parties Seven of the Davie Home Dem­ onstration clubs this wnek will hold their meetings in the form of Christmas parties and the home seen* ard leaders will de-' liver Christina", programs. j Advnnce - Elbaville Club will meet for a covered dish luncheon! on Wednesday, Dec. 16, beginning at 10 a.m. Mrs. D. K. McClam-j rock, County Arts and Crafts, Leader, will have charge of the program. I Fork Club will meet in the. community building on Wednes- day, Dec. 16, at 2:30 p.m. Gifts will be exchanged. | Cana Club will he hostess to Pino - Farmington Club on Thurs­ day, December' 17, at . 2:30 p.m. Gifts 'will be exchanged. i Concord Club will meet wi'h. Mrs. Frank Crotts on Friday, Dec. 18, at 2:30 p.m. Mrs. Kathleen Sprye, co-hostess. Gifts will be pxchanged. Cooleemee Club will have a covered dish supper at the home of Mrs. A. T. Lewis on Friday,® Dec. 18, at 6:30 p.m. - Center Club will be hostess to their families on Friday, Dec. 18, at 6:30 p.m. . 1 Jerusalem Club will meet with Mrs. George Apperson on Friday, Dec. 18, at 7:30 p.m. Christmas stockings will be filled for shut- ins. Gifts will be exchanged. Christmas Program To Be Presented At P.-T. A. Meeting A Christmas program will be presented in the High School au­ ditorium Monday night, Decem­ ber 14, at 8 p.m.. The program will include tab­ leau scenes portrayed by the 7 and 8 grade students conducted by Mis Ruby Fleming and the following Glee Club numbers di­ rected by Mhs Joan Murray. “The Christmas Hymn,” mixed chorus; “Hark The Herald Angels Cing" nn.. “..r.ecls We Have Hour On High,” by girls chorus; "Si­ lent Nijht,” “Bring A Torch Jeanett Isabella” “The Birthday Of A King” “The First Noel” and "Come All Ye Thankful” by mix­ ed chorus. Evona York, soloist, will sing “O Holy Night" and Reba Fur­ ches, Shirley Wyatt, Jack Naylor and Harry Osborne will sing solo parts in the choruses. Beta Club Meetinp Held Monday Night The Mocksville Beta Club met last Monday night at the home of Jane Robinson. The president, Geraldine York, presided over the bu'iness Chr'stm". g^.mes \. ore play id and Christ­ mas carols sung after tl‘ e business meeting. Refreshments were served and the meeting was ad­ journed. ■ The member ; of the Beta Club are Geraldine York, president; Duke James, vice-president; Jane Robinson, secretary; Uancy Chesh­ ire, treasurer; and Harry Os­ borne, Robert Latham, Rosaline Steelman, Judith Ward, Eugene Williams, Paul Henry Richard­ son, Alan Phillips, Barbara Plott, Eva Strider, and Mrs. Jim Wall, adult advisor. Party and Dinner To Be' Held at Baptict Church On 'Thursday ov-rrnp, Dec. 10,| the Mpry-Martha Sund.'.y rchool Class of the Fir’t Baptist church vvi'l have a Christmas party at the church. Gifts will be ex-j changed and refreshments served, after tho business session. The' members will bring white Christ-j mas gifts to be distributed at a later date. Friday evening the Horn Bible Class will have a turkey dinner at the church. Twenty-five are expected to attend. The class mem­ bers will be accompanied by their families or friends IT PAYS TO ADVERTISE Pr in fess Theatre Tliurs. & Fri.: “THE GREAT SIOUX UPRISING” In Tech­ nicolor. With Jeff Chandler. Also Cartoon & News. Sat.: “HELLDARADO” With Roy Rogers & Dale Evans. Al­ so Cartoon and Serial. Mon. & Tnes.: “ ALL I DE- SIRE” wi'lt Barbara Stanwyck & Richard Carlson. Also Car­ toon & News. Wed.: “PLUNDER OF THE SUN.” With Glenn Forttand Diana Lynn. Also Cartoon and Comedy. Phone 182 for Show Time I Stratford’s is the store to get that Christmas ELGIN ‘A GIFT OF FURNITURE IS A GIFT THAT WILL BE REMEMBERED’ s jy3 SyyJJ ’ Lamp Shades w Boudoir Lamps Smokers GIFTS UP TO $5 Table Lamps Carpet Sweepers Pictures GIFTS UP TO $50 DesksTelephone Benches Cedar Chests Hollywood Beds Desk & Chair Sets Mattresses RugsChairs of all Kinds Floor Lamps 3-Way Lamps Traffic Appliances Tables of all Kinds Radios Phonographs 5 g n6V IVVavVVyv8 IVV End Tables Lamp Tables Throw Rugs Child’s Rockers Hassocks GIFTS UP TO $15 5 Smokers GIFTS UP TO $25 RadiosRecord Player Telephone Benches Bookcases fj Appliances » Wardrobes yw Floor Lamps “ Table Lamps | Record Cabinets Table Lamps Vanity Lamps, Student Lamps Mirrors « ! Pictures Cocktail Tables Lamp Tables Coffee Tables End Tables Tier Tables GIFTS UP TO $10 Table Lamps Vanity Sets High Chairs Play Pens Chrome Chairs § CribsTraffic Appliances Boudoir Chairs Pull up Chairs y y yI y y g 1 Sf| Adaptable Tables 15 SyVs s Throw Rugs Linoleum Rugs Traffic Appliances Cricket Chairs Telephone Sets Sewing Cabinets Mirrors Venetian Blinds Pictures Traffic Appliances Card Tables Throw Rugs Hassocks g V g y y y y y v y Just the Gift for HER! A Lane Cedar Chest YOU CAN BE SURE WHEN YOU GIVE • Westinghouse • WESTINGHOUSE WESTINGHOUSE WESTINGHOUSE WESTINGHOUSE rfand some waterfall design In rich American walnut—big 48" *i*c. Has self-ruing tray. ONE GARMENT SAVED PAYS FOR REFRIGERATORS RANGES LAUNDROMATS 0 WESTINGHOUSE CLOTHES DRYER• WESTINGHOUSE TELEVISION SETS 9 WESTINGHOUSE IRONERS• WESTINGHOUSE ROASTERS O WESTINGHOUSE RADIOS All Types of Westinghouse Small Appliances such as WAFFLE IRONS—PERCOLATORS — IRONS — TOASTERS — SANDWICH g GRILLS. ieieietg'c'eie‘cis'ctcieigtgtcte'gigt«te'e'stgte!etctg‘e<£>cietsiet3«is<s'e!ets'ete<e'gte!s'€'s<e'g'e%'eie<eic'c:«'cic<eis!e!gieie<c'eietzicieu:it;iet2«rete'e's<e‘e!e<e!cie!c<eig -—-TERMS ARRANGED TO SU IT YOUR CONVENIENCE--- D a v ie F u rn itu re C o. Phone 72 “On The Square’Mocksville K!«!e<€<e!s>s,-e>e«'zie««’.s>eie<e!c<ete!£<s<£te!2te!£!€!£is:ste<ci£<gi«!e!2is!£ie<g‘ste<eis<e<£<si£ie<«*e‘e«*5‘eis!ei«,5teie*sis |e‘e‘£‘s!t>e«ig PAGE EIGHT THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 10, 1953 Mr. and Mrs. C. W. Efird en­ tertained at a family Christmas party at their home here at Sat' Mr. and Mrs. Bob Griffin of High Point, Mr. and Mrs. Lester Efird of Winston-Salem; Miss Lois Efird and Jimmie Hall of States-' ville. Pfc. Herman Efird left Mon­ day morning, Dec. 7, for Camp Concord urday evening, Dec. 5 honoring Stone, Calif., for an assignment their son, Pfc. Hermak Efird, who overseas. He traveled by train, is spending a 30 day furlough 2 ^rom Charlotte. ■with them. Those enjoying this; h . C. Foster has a'tractively occasion were Pvt. Efird, Biss painted the interior of the large Betty Lou Griffith, Elsie Efird, dwelling house situated on his K a V » tf If I W & VVV g s F u li e r a 1 The WSCS met at the home of Mrs. V. A. Swicegood, Saturday afternoon. Mrs. Carrie Tutterow return­ ed home last week after visiting her sister two weeks. - <( Mrs. John Walker of Mocks- vilel ‘and Mrs. J. N. Tu'.terow '■■hopped in Salisbury last Mon­ day. Mrs. V. A. Swicegood and son, Joe, visited Mr. and Mrs. Boone C. Foster Saturday night. Mr. and Mrs. Flake Sammons and family of Mocksville visit-- ed Mr. and Mrs. S. D. Daniel Monday night. Mr. and Mrs. J. N. Tutterow and ton, Nelson, visited Mr. and Mr-.. Junior Sechrest, Saturday night. Mr. and Mrs. W. R. Davis shopped in Salisbury Saturday morning. j Several from this community I attended the sub-district WYF meeting at Cornatzer Thursday riight. E. P. Holder, 76 Funeral services for Edward Pinkston Holder, 76, of Advance, Route 1, were held Tuesday at the home of a daugh’er, Mrs. Mamie Wood, with whom he was stay-' ing. Rev. Sam Tesch, the Rev. J. P. Crouch, and Rev. George Bru­ ner conducted the services. Bur­ ial was in Woodland Cemetery. 1 Mr. Holder died at the home of ' his daughter, Mrs. Wood, at 12:55 1 a.m. Sunday morning. He had been I in declining health for several years and critically ill since Fri­ day. He was born June 23, 1877, in Clemmons, the son of Thomas and Annie Welfare Holder. He moved to Winston - Salem while still young. Until his retirement in 1949, he was employed by Briggs - Schaffner Company. He was a member of Immanuel Mo: ravion Church and Liberty Coun­ cil No. 3, Junior Order. I He Avas married three times, first to Miss Maggie Johnson, then to Miss Lula Mabe and then to Miss Bessie Jones. All preceded him in death. | Surviving are three daughters, Mrs. Wood, Mrs. Mary Huffman of Pinevilie and Mrs. Ella Yates of Walnut Cove; one son, Ralph Holder of Pensacola, Fla.; and 15 grandchildren and 11 great-grand-] children. IID CLUB MEETING The Mocksville Home Demon­ stration Club will meet on Thurs­ day, Dec. 10, at 7:30 p.m. in the Fellowship Hall of the First Methodist Church. Hostesses will be iClrs. Roy Brown, Mrs. W. Qi Grigg and Miss Mary Heitman. Christmas gifts will be exchang­ ed at the conclusion of the meet­ ing. IT PAYS TO ADVERTISE TELEVISION PROGRAMS Siler Flower Shop Phone 113 Mocksville, N. C. «im m ic«!c'c«ic'c«'c'ctc««'c!«<ctc«*'c««>c>c'««!<«'c>c!cictcic>c>c«|ctc>c>c>c«tt g i v e y o u r f e e t h a p p y h o l i d a y ^ If you’d like a pair of grateful IN LEATHER , feet, play Santa to them with Haymakers. The craftiest shoes ever crafted by hand, they keep you unaware of their very existence.. even while they wing you around the clock and the Calendar. Handsewn and handlasted of a single shell of softest kip-calf-skin, you’ll never want to take them of! till, maybe Xmas ’55! 814.95 *14.95 *15.95 Widths AAAA to C, Sizes AVz to 11 RedBlueBlackBrownGreenWhite OXFORDS BlackBrownWhiteBenedictine dairy farm here. Mr. and Mrs. Wade Stroud will move from the old Foster home into this house at an early date. E. D. Lagle, Xenncth and Ilam Ratledge and John Gaither, who are presently employed at Clear Wa'er S. C. by the Pilot Freight Carriers, Inc., spent the week end here with their families. Construction of the telephone line is underway through this community. Poles were erected the latter part of last week. General Electric —Sales and Service— DANIEL Furniture & Electric Company AT OVERHEAD BRIDGE MOCKSVILLE, N. C. Seats Theatei YADKINVILLE, N. C. Thursday & Friday, Dec. 10 & 11“LITTLE BOY LOST” with Bing Crosby & Claude Dau­ phin. Also selected short subjects Laundry and Expert Dry Cleaning Mocksville Laundry & Dry Cleaners DEPOT STREET Saturday, December 12 DOUBLE FEATURE“Blood On The Moon” with Robert Mitcham, Robert Preston & Barbara- Bel Geddea Also“NEVADA BADMEN” With Whip Wilson Sunday & Monday, Dec. 13 & 14“HANS CHRISTIAN ANDERSEN” in Technicolor. Wth Danny Kaye and Farley Granger. >, Tues. & Wed., Dec. 15 * 16“SEA DEVTLS” In Technicolor. With Rock Hud­ son & Yvonne DeCarlo. COWnNG~THURSDAY, DEC. 17Lash. LaRue In Person ManufacturersofLadies’s Pajamas ----------•----------- MONLEIGH GARMENT CO. SUNDAY MOVIES Shows at 1:30 3:00 9:00 Doors Open l.p.m. and 8:30 p.m “OUTFITTERS toMEN” ----------• -----------*TREXLER BROS., Inc. SALISBURY, N. C. 9:00- 8:159:45lo:oo 11:3012:0012:15 12:30 12:451:302:u0 2:303:U0 3:304:00 4:30 , 5:00 5:155-30 0:156:30 0:45 7:00 7:15 7:30 7:45 8:00 8:30 9:00 9:30 10:00 10:30 11:0011:10 11:1512:30 9:00 9-15 9:4510:00 10:3011:0011:3012:00 12:15 12:3012:45 1:302:002:30 3:00 3:30 4-00 4:30 5:00 5:15 5:30 6:156:30 6:45 W SJS W INSTON-SALEM CHANNEL 12 THURSDAY - 3— 1*11 B uy That 3—M orning Show 3— G uiding Light 3— A rthur G odtrey 3— Strike It Rich 3—Valiant Lady 3— L ove O f L ife 3— Search F or T om orrow 3— Carolina C ookery 3— G arry M oore 3— B etty Feezer Show 3— A rt Linkletter 3— N ancy Carter Show 12— K ate Sm ith 3— B ob Crosby 3— A rthur Sm ith 12— A tom Squad 3— 12— On Y ou r A ccount 3— C hildren's N ew sreel 12—G abby Hayes 3— Story Painter 3— L one R anger 12—-H ow dy D oody 3— V isit W ith Santa 12—Roundup T im e 3— Jane F rom an *» 3— Esso R eporter . 12—N ew s and W eather 3— W eather R eport 3— A n yb ody's G uess 12— Johnny Com as Presents 3—Spin T o W in 3—D ouglas Edwards .12—Curt L. R ogers Show 3— H obby House 12— Cam el N ew s Caravan 3— B oston B lackie 12— G roucho M nrx 3— I Lead T hree Lives. 12—T -M en In A ction 3— L u x Theatre 12—D ragnet 3— B ig T ow n 12—F ord Theatre 3—M eet M r. M cN utley 12—M artin K ane 3— P lace T h e F ace 12—N ew s Final—flign o ff 3— N ow s and Sports 3— W eather 3— Lnte Show 3— S ign -off FRIDAY 3— Christopher Show 3— M orning Show 3— G uiding Light 3— Jack Parr Show 3— W heel o f Fortune 3— M an A round The House 3— Strike It R ich 3—Valiant L ady 3— L ove o f L ife 3— Search F or T om orrow 3— Carolina C ookery 3— G ary M oore 3— D ouble or N othing 3— A rt Linkletter 3—B ig P ay off 12—K ate Sm ith 12— K ate Sm ith 3— B ob Crosby 3—M ovie M atinee 12—W elcom e T ravelers 3— 12—On Y ou r A ccou n t 3— Junior R ancho 12— A tom Squad 12—G abby H ayes 3—H opalong Cassidy 12—H ow dy D oody 3—F ootball T his W eek , 12—R oundup T im e 3— C oke T im e 3—F.sso R eporter 3— W eatherm an 12—N ew s and w eather 3— A n yb ody’s G uess .12—Johnny Com as Presents VVBTV CHARLOTTE CHANNEL 3 7:15 3—D o It Y ourself 7:30 3— D ouglas Edwards 12—Eddie Fisher 7:45 3— P erry C om o 12—Cam el N ew s Caravan 8:00 3— M am a 0 12—G arrow ay A t Large 8-30 3— T opper 12—L ife of R iley 9:00 3— P layhouse o f Stars 9:30 M irror Theatre12—A m erican Inventory 12— Boston B lackie 10:00 3—N ational Theatre 12—B oxin g /10:30 3— P ride o f T he Fam ily 10:45 12— News Final (Sign o ff). 11:00 3— N ew s A nd Sports 11:10 3— W eather Report 11:15 3— Late Show 12:30 3—Sign o ff SATURDAY 9:00 3—Mr. W izard9:30 3— Space Cadet 10:00 3— Captain M idnight 10:30 3— Johnny Jupiter11:00 3— Cisco K id 11:30 3— Sm iling Ed M cC onnell 12:00 3—B ig T op1:00 3—W estern - Feature 2:00 3— B ig Picture 2:30 3— P ro Basketball (D um ont)4:15 3— T B A 4:30 3—T alent P atrol 5:30 3—S ky K ing 12—F ilm Feature 6:30 3—F ireside Theatre 12—This is T he L ife 7:00 3— Burns and A llen 12— A m erican Forum 7:30 3— Beat The C lock12— A rm chair Playhouse 8:00 3— Jackie G leason 8:30 12— A m ateur H our 9:00 3— Foreign Intrigue 12—F ilm Feature • 9:30 3— Pepsi Playhouse 12—Show o f Show s 10:00 3— F ord Theatre 10:30 3— F our Star P layhouse 12—Hit ParaHe 11:00 3—W eeks N «w s Tn F e’ Mpw 12— N ew s Final (Sign O ff)11:15 3—W restling SUNDAY 12:00 3— This Is T he L ife 12:30 3—N am es T he Sam e . . 1:00 3—Stu Erwin 1:30 3— Frontiers o f Faith 2:00 3— Redskins F ootball G am e 12— P rofessional F ootball ' 4:30 3— A dventure 12—F ilm Feature 5:00 3— O m nibus 12— Excursion 5:30 12— Youth W ants T o K n ow 6:00 12— Frontiers o f Faith 0:30 3— M irror Theatre12— K ukla, Fran and O llie 7:00 3— O zzie and Harriet12—W inchell and M ahoney 7:30 3— J a ck 'B e n n y 12— Mr. Peepers 8:00 3— 12— C om edy H our 9:u0 3— Fred W aring 12—T V P layhouse 9:30 3— Man Behind T he Badge 10:00 3—W ho Said That12—Letter T o Loretta 10:30 3— W hat’s M y Line 12—M an A gainst C rim e. il:0 0 3— Sunday N ew s Special 12— N ew s Final S ig n -off 11:15 3— Toast o f T h e T ow n '2:15 3— Sign o ff JEWELRY ANDEXPERT WATCH REPAIRING ----------•----------- FOSTER’S WATCH SHOP TELE - KING TELEVISION -Sales and Service— ----------•-----------C. J. ANGELL APPLIANCE CO. MOCKSVILLE, N. C. R. C. A. WESTINGHOUSE -Sales and Service— DAVIE FURNITURE CO. PHILCOTELEVISION—Sales and Service— ----------•-----------Hendricks - Merrell Furniture Company Salisbury St. - Moeksrille S u rp rises Wo*ch for the N E W C H E V R O L E T FRIDAY, D E C 18 PHONE 156 th e n e w C h e v ro le t a t . . . Pennington Chevrolet Co;, Inc. MOCKSVILLE, N. C. THURSDAY, DECEMBER 10, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE PAGE NINE! * ■ & * * ON YOUR CHRISTMAS GIFT LIST! We're Ready With the Greatest Selection of Gifts for Men and Boys We've Ever Shown v . . Attractively Displayed for Your Shopping Ease ... And All Under One Roof rC’I 100% Wool SPORT COATS :Sol id Colors and Plaids. *19.95to*25.00 "jreufoy Sport Ccats ,:s Weave Pinwale. All Colors. : 695 ;: !::r Coidursy..Sport Coats $9.95 100% Wool GREY FLANNEL SUITS<■» ' 2 Button — Patch Pockets. *29-95 Gaberdine Topcoats All Wool and Mixtures. A- A Really Nice Gift. *2f 95 to *32 50 ’ . White and Colors WINGS DRESS SHIFTS :White With’ French Cuffs . ...■].... .$2.98 ■Colors With French Cuffs . .... . ...........$2.98 ■ iRound Collars ................................ .$3.98' WINGS GABARDINE SPORT SHIRTS *4.98 ARROW DRESS SHIRTS W hite ... ............... •• C olors''.. . $3.95: .$4.50. f i All Wool ; • ■ ■ FLANNEL PANTS All Colors *10-95-*16-50 Other Pants $5.95 and $13.95 Dan River and Rayon SPORT SHIRTS All Colors *2-98 lo *4.98 All Wool ' - ' Sleeveless Sweaters *1.98 lo *4.98 .. Gabardine SPORT SHIRTS ' All Colors ‘2.98 - *3.98 Flannel .. SPORT SHIRTS Plaids and Checks *2.19io*2.98 Corduroy SPORT SHIRTS All Colors Orion *4-98 Gabardine Jackets ond Sur Coats Flannel and quilt-lined. ■ Zipper front. *7.50 to *12-50 FELT HATS Friendline .$5,00 ■Adam ......................$7.50 SHOE SOCKS For lounging. Leather soles ..... flannel top, *2.98 it Slipover"' SWEATERS All Wool and Orion7 95 to $H 95 All Nylon Adjusto" Size Sox One size fits all sizes, 85c and *1.00 OTHER SOX 39c to $1.00 . A Large Selection TIES To please everyone, *j. 00 and *2.00 MEN'S PAJAMAS Broadcloth ,,$2,98 to $4,95 Flannel .$3,49 to $3.98 Sizes ABCD *4.98 All Wool-Coat SWEATERS ‘4.98 to *8-95 Boys’ 100% Wool FLANNEL PANTS Greys and blues, some splash weave. Sizes 6 to 20. . ‘6.95 and *8-95 ’ Boys' Gabardine SPORT SHIRTS Button-down collars, flap pockets. Assorted colors. Sizes 6 to 18. *2-98 Bovs' Cotton Flannel SPORT SHIRTS Plaids and solids. Sizes 4‘ to 18. *1.59(0*1.98 Boys' Quilted Wool Lined GABARDINE JACKETS .... Mouton collars. Sizes 4 to 20. Assorted colors. *6-95 to *14.95 Boys' 100% Wool SPORT COATS Assorted smart colors. Sizes 6 to 18. *12-95 . Boys' White DRESS SHIRTS T-ittc oxford cloth; French cuff; and button down collars.- *1.98 and *2-98 JUNIOR DRESS SHIRTS . Boys' Munsingwear KNIT SKI PAJAMAS Assorted colors.-Sizes 2 to 20. *298 Boys' Sanforized BROADCLOTH PAJAMAS Middy and coat style. Long sleeves. ‘ 1.98 and *2-98 White'and .patterns, 'French cuffs with- links and - matching bow’tie. Sizes 4-to 12.' •• ' *2.98 BOYS' TIES ■ . Four-in-hand, readv-tird and bow ties, . . . . 50c lo*l .00 Boys' •'' ■ LEATHER BELTS 59c -*1.00 Boys1 FUR-LINED LEATHER GLOVES Cork; tan and black. *2.98 and>3.98 Fleece-Lined RED RIDER GLOVES 39«l»79« Boys', Brown Leather” HOUSE SHOES Soft padded soles. Sizes 3 to 6. *269 Men's Brown Suede Leather Moccasin • Two-tone, soft soles. Sizes 6 to 12. *2-49 Men's 100% Sheep-Lined Suede House Shoes Soft padded soles. Sizes 6 to 12. *3.98 • Men's All Leather HOUSE SLIPPERS Leather soles, rubber heels. Sizes 6 to 12. ‘2.98 to *5.95 ? Men's Brown LEATHER MULES Soft padded soles. *2-98 Men's Sheep-Lined LEATHER SLIPPERS Leather soles, rubber heels, *4.98 SALISBURY, N, C, BOYS', STORE ■CORNER MAIN AND F I S m j PAGE TEN THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 10, 1953 4 Corners Miss Ruth Feimsler, bride-elect of Dec. 23, was honored Friday evening in the home ec. build­ ing by the ladies of the choir of tho Methodist church and her Sunday School class teacher,1 .“ ‘j Mrs. S. L. Jurney. Miss Feimster wore a becoming frock o f ' the new fall shade of brown. She was presented a corsage by her hostess. .Contests were conducted by Mrs. Fred Albea and Mrs. James Lambert. Miss Feimster was showered with many nice gifts including several pieces of her crystal. Refreshments were served from ’ a large table in the recreation room which was overlaid with a white linen cloth. A bridal scene on a reflector centered the table which was flanked by candles in crystal holders. Punch was served by Mrs. Cloude Burgess. Decorat­ ed bridal squares of green and white and nuts were also served. Birthday Dinner Mrs. J. L. Grose had a birthday in late November and her chil­ dren gave her a real birthday dinner. Those sharing in the dinner were Mr. and Mrs. Clar ence Millsaps and daughter, Miss Annie Lee; Mr. and Mrs. Escar Gilbert of Siatesville; Mr. and Mrs. R. V. Campbell and son of Winston - Salem; Mr. and Mrs. Philip Grose and son, Phil, Jr., of Charlotte; Mr. and Mrs. Bill Johnson and daughter, also of Charlotte; Mr. and Mrs. Ralph Buchanan and son of Boone; Mr. and Mrs. Howar Moore and Mr. and Mrs. Gilbert Grose and daugh­ ters, Jane and Sue, of Harmony. The den.h of Dr. Raymond E, Connell is a great loss to the people of Courtney Baptist Church and to everyone that know him. Funeral services were conducted at Courtney Baptist Church Monday at 2:30 p.m. Bur- was in the Memorial Cemetery in’ ICannapolio. Thanksigving dinner guests of •Mr. and Mrs. C. S. Dull were Mr. and Mrs. Paul Rickard and chil- 'dren and Mrs. Stella Call of Mocksville. Mr. and Mrs. William Ratledge and daughter,, Beverly, Mr. and Mrs. C. S. Dull and daughter, Peggy, and Roger Dull visited Santa Claus last Friday evening in Winston-Salem. Mrs. E. J. Shelton was honored Sunday on her 83rd birthday an­ niversary by her chillren and grandchildren. She received many nice gifts. Mr. and Mrs. Gene Ellis were dinner guests of C. S. Dull Sun­ day evening. Mrs. L. S. She'.ton and daugh- MHS News By ED ROWLAND Tuesday night in the local gym the Mocksville Waldcats opened the 53-54 basketball season by dropping a couple of games to the strong Mills Home outfits. Mocks­ ville girls lost their game by sev­ en points, 48-41; and the boys lost by eight points, 56-48. Tho games marked the coaching de­ buts of bo h Mrs. Hayes as the girls’ mentor and Mr. Delapp as the' boy’s. Mocksville girls couldn’t seem to get started in their game, and Mills Home rolled up a nine point 'ead at the end of the frist half. Lena Cornatzer was the offensive star for Mocksville, leading both 'earns with a total of 27 points. In tHe second half of the twin bill, Mills Home used the far.t break to deadly effect in jump­ ing to a 14-7 lead at tho end of the first quarter, and to 33-13 at the half. But Mocksville, fight­ ing back in the last half, coun­ terattacked by scoring 12 more points than the visitors. Gene ter, Edna Ann, and Grady w ent:PoPlin and Johnny Braswell led. the scoring with 18 and 17 points mistakes were still fresh on their fc&SiaSiSiSiMiSiSiSiSiSiSiSiaiSiSiMiSsSiSiaa&aaSiJiaaiaiaifcSiMiaiMiSiSiMiMi* respectively. \ minds, Coach Delapp held a scrim- j ft * A * ------------- Image session immediately after|{jj The school was surprised and’ the game to polish up their game ^ happy to learn Friday morning and get them ready for their other K tha ; J. C. Clontz had been pro- two pre-Christmas contests. | sentcd the Jaycees’ annual award _ ., ,. , j Both of these game1; are at home,1Sto the played on the Mocksville b... , , .'the first one on the 11th with QHigh footba.l team termed Most ... , , ,, I ft„ T , , „ , . Mineral Springs and one on the hValuable.” The award was based ... ... ,, ,„ . , . 15th . with Woodleaf.on all-around performance; in •games, and on the practice field.! This is the first time that the The Monogram Club held a . , , , j , mee'ing Monday during whichaward has been presented to an ,, . . , . ,, , , T . . . they elected a new pair of con-underclassman, and J. C. is just . ... , ., . j , cession committee chairmen. Chos-a junior he will be around next en to replace Harry Osborne and Doris Jones were Edrie Green and Mack Kimbrough. Also' elect­ ed was a publicity committee to j u . . nr * ir j, ■ • • ^ push attendance at our home ed host to West Yadkin in a pair oi T , ,, _................,-i.u basketball games. year to give our gridiron foes a rough time. Friday night the Wildcats play- A Word to the WISE r „ , .. Presldf"ti^ LoansJim(my Taylor presided over the k meeting. basketball games which the vis­ itors promptly walked away with. •Mocksviile girls were never in the game at all as West Yadkin Miss Dorothy Gaither Morris, ^ rolled io a 13-3 first quarter lead., Salem College student, spent1 * As the game progressed, the vis-| Sunday with her paren's, Mr. and \ g ilors coasted to a 42-10 victory. Mrs. E. C. Morris. Miss Morris /< In the nightcap of the action,' will arrive on D ec.. 17, for the - Get Low Cost l Long Termed Home Financing | That Can save You Money, Time and Worry Loans Made to BUY Call or Stop REMODEL For Information REFINANCE Mocksville Building & Loan Ass’n.West Yadkin’s boys showed sur-( Cfiristmas holidays. She will re-1 ^ prising mid-season farm (andj.turn to Salem on Jan. 4. « Mocksville the lack of almost any) | J. K. Sheek left by plane Sun- « in winning their game in a walk- day on a business trip to Miami, ^ ____________________________________away, 67-44. While Mocksville’s Fla. | shopping in Salisbury Saturday. | isisi>1aa3i*asisisi»!2i9isisiaista3isia3isisi9i3)si»isia9i**i>i*i»isjsiai9i*i»i»iasisi9isiaa9i»isisisis.»»»ai>i>qjnrt»)»1»i»i*i8isi»i2;3ia3isi*i»isia*i»,»i»isi»)a»i>i>i*i»»)»i>i*>i»i»i*i»i*»i»n»»i»i>m»iai>iji>ijmi,j,jt M OCKSVILLE, NORTH CAROLINA Oak Grove The W. S. C. S. will hold its regular monthly meeting at. the community hut Saturday night at 7:30. Mr. and Mrs. Gilbert Atwood and family left Friday morning for Baltimore, Md., to attend the wedding of James Barker, who is Mrs. Atwood’s brother. Mr. and Mrs. Frank Turner and son. Von, of Statesville were the guests - of Mr. and Mrs. James York, Sunday. James R. York and daughter, Evona, spent Thursday night in Fuquay Springs with Mr. York’s brother, W. C. York, and Mrs. York. They attended the N. C. Folklore Society meeting Friday in Raleigh. Seven members of the Oak Grove MYF attended the sub­ district MYF meeting at Cornat­ zer Methodist Church Thursday night. They reported a fine pro­ gram and an enjoyable meeting. Misses Ella Mae and Dora Leon­ ard shopped in Winston-Salem Mocks The W. S. C. S. held their monthly meeting with Mrs. Charles Carter. There were sev­ enteen member, presen t and Christmas gifts were exchanged af'er the meeting. Mr. and Mrs. E; M. Jones of Thomasville spent Saturday with Miss Grace Jones. Mrs. J. W. Beauchamp spent Saturday night with Mrs. U. H. Phelps of Advance. Miss Lucy Foard Phelps and Mrs. Bob Bailey shopped in Win- ston-Salem Saturday. SHADY GROVE PTA The Shady Grove PTA will j hold its regular meeting on Mon­ day, Dec. 14 at 7:30 p.m. A Christ­ mas program will be presented and special entertainment fea­ tured. Sa* urday. Mrs. Pansy Koontz shopped in Salisbury Tuesday. Mr. and Mrs. Charlie Potts of Route 3, spent Sunday after­ noon with Mr. and Mrs. William Summers. Mrs. Forest Whitaker and Mrs. W. L Mullis went shopping in Salisbury Tuesday. Billy Summers, little son of Mr. and Mrs. Wiliam Summers, has returned home from the hos­ pital after on operation and is doing fine. Sunday visitors of G. W. Mc­ Clamrock were Mr. and Mrs. Wil­ ey McClamrock and Mr. and Mrs. Arthur McClamrock of Clemm- IT PAYS TO ADVERTISE Kfi«rt« K %« H dV««K You'll serve Coke often during the holidays — G e l c m e x t r a s u p p S y t o d a y hristmas Trees and all the trimmin't.. .Every­ thing for your Christmas celebration in one stop on the 'Foodland Special'—Yule foods, beverages, pastries and that all-important oven-ready turkey... ...W hy not bake your gift? Mmmm. Delicious, and so •asy now-a-days... See our complete line of baking supplies. How to be a Better Cook ...and save money tool ■Y 7P iO A y<& & (tt Need just a littl* tomething to put io that biking dish (of May —or in chat salad bowl for Anne-Of in that basket tor Sister Sue? Fill them with cookies — and then wrap gaily. Your gifts will be enjoyed twice as much. (Makes about 8 dozen 2*inch cookies) 1 cup buttir 2 teaspoon* IYj cups brown baking powder sugar 9 cups sifted cup granu* alUpurpose loted sugar flourt tggs * Vi cup undiluted ’ Vi Itaspoo** Carnation vanilla Evaporate* faaspoon taK Milk Blend bUtter wiih sugar, eggs, and vanilla until light and fluffy. Sift salt, baking powder and flour together. Add co sugar m ixture alternately w ith Carnation. Mix well. D rop cookies from a teaspoon onto buttered baking sheet. Bake in hot oven (4 0 0 °F .) about 8 co tO minutes or until slightly browned. Remove from sheet and place" oa racks to cool. Decorate with wal­ nuts or pecans, if you wish, before baking IDEAL PLASTIC Tea Sets $1.98 24 INCH—COME AND SEE THEM 1 Dolls 81,95 | Christmas Puzzles & Coloring Books 25c fch HOLIDAY FRUITS Bananas 12 c lb TURKEY PLACE YOUR ORDER NOW 250 SIZE CAflmr/OA/ M / I K 3 Tall Cans 39c Oranges 2 doz 35c | Toms 150 SIZE Tangerines 2 doz 29c PURE FORK 55c lb ENGLISH Walnuts Pecans Coconuts 35c lb 35c lb 19c each Sausage Slab Bacon 33c lb 49c lb I LEAN TENDER Beef Roast 39c lb I Camels — Luckies — Chesterfields § ? iio r m e l s p ice d goid Goki — phiilip Morris — Paii | Luncheon Meat 39c lb iMallHerbert Tareyton. ••Coke* IOTTIED UNDER AUTHORITY OF THE COCA-COLA COMPANY IV WINSTON COCA-COLA MOTTLING COMPANYU a registered trade-mark 1933, THE COCA-COLA COMPANY tgictgi«!gtg!g«s'«ig«!g!(;!s,€!e!s!ets’e!5i«iseeisis«!gie!e:6ig!s!etgie JIFFY Pie Crust Mix ..19c § WHITE h o u se PUDDINGS 2 for 21c Sliced Apples...27c DEL MONTE 2 VS SIZE CAN Pumpkin.........22c 1 MONARCH SHORTCAKE. 1 LB. 1 OZ. CAN Peaches 33c can Fresh Country EGGS 69c doz. . SwansdownCAKE FLOUR 45c SUGAR 5 lbs., 49c Strie'man Coconut Choc- if olate DropCOOKIES | 1 Ib.,,49c I 3)%3tK3l%9l3t3l5;».Si%%3iS.3l3idl3l3i3;3i3i3i3i3iSl3i3iSgSiSi3;S)S)%3t3;Si%3iSj3iB]a3i»lS]%3]3i9iSi3g%9l3'.S)8 3iai9l9)Sl3)Sl»3)3l3i9t9l»,3iSi3)3l%9lS)9l».Si3)9i».3iSlSl3t5lS)>i9l3!3l3^%%3l3i%%>i9i3l3;%>,3l»g»l3iS!3i3i3l9l jjjr iio r m e l B J L 0 / 7 / / S / * / ) i LUZIANNE COFFEEm 4 rgarine 19e lb White Label ............... 7.1cRed Label .................. 64c WITH COUPON FROM MAIL igigisiatgieiete ie’-s«tstg!«!£is!eic'€,€ «,-c!c'€<s,-e,€’e!e!ateifiist6i€ieic«si€«!«ic WEST GROCERY WILKESBORO STREET MOCKSVILLE, N. C. THURSDAY, DECEMBER 10, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE PAGE ELEVEN C L A S S IF IE D A D R A T E S : T W O C E N T S P E R W O R D P E R IN- S E R T IO N . M IN IM U M C H A R G E 5 0 C . C A S H W IT H O R D E R . C A R D O F T H A N K S $ 1 .0 0 , C A S H W IT H O R D E R . F O R SALE—7 acres lam l, Farm ington T ow nship, t\-'a m ile south K in g’s Store. Best offer. A lvts Laird. 12 10 2tp PIA N O S— W e have the piano you have been look ing for. P rices begin at $79. Sm all deposit wJll hold any piano for Chrism as delivery. Start paym ents n ext year. Term s to su»t you. K L U T T Z M U SIC CO M PAN Y, G ranite Q uarry, N. C. 12 3 3tp IF YO U AR E HON EST A N D A R E NO T SATISFIED with present Job see Paul A n gell on R oute 4. Y ou can live in D avie, Iredell or R ow an County. 12 10 2tp F O R RENT— A house on R oute 4. See Paul A ngell on Rt. 4. 10 10 2tp F O R SALE—T w o lots, W . A . Blake prop­ erty. One lot 5.7 acres, another 10.9 acrcs fronting the B lxby. Fork hard surface road. See or call B. C. BRO CK , office tel. 151. 12 10 2tn LOST-—on e saxaphone, E-Flat A lto. H ol­ ton m ake, cilvcr,. factory serial num ­ b er 11275. In black carrying ease bear­ in g w ords "C ataw ba C ollege. Salis­ bury. N. C ." A ccessories included. L eft in car w hile receiving a ride from Ca­ taw ba C ollege to D avie Crossroads. N o­ tify D avid E. M ilholcn at No. 4 C ircle D rive, C ooleem ee, or Cataw ba College, Salisbury, N. C. 12 3 2tp F O R RENT— T w o 4-room du plex apart- . m ents. M odern conveniences or w ill rent at a w hole. V ery reasonable rent. * See M rs. W . J. M cD onald, Rt. 2, M ocks- , vUIcj or.The Enterprise. 11 26 tfn » F O R W ELL BO RIN G AN D CASIN G FURN ISHED, $2.75 PER FO O T. A L L W O R K G U ARAN TEED, 5 Y E A R S E X ­PERIENCE. C A L L COLLECT, C. E. SE T 2E R * St SON, C A T A W B A , N. C., PH O N E 2921 OR 1927. 10 29 8tp W A N T E P —- HAVe yd^r prescription* filled At H A L L D Rw G CO M PAN Y. Phone 141, M ocksvillo, tfn G E N E R A L E LECTRICAL CO N TRACTIN G and E lcctrical Service. N. C. Licensed E lectrician a n d'C on tra ctor. RE A CER* TIF IE D CO N TRA CTO R AN D D E A L ­ER. RO D W ELL ELECTRIC CO M ­ P A N Y , M ocksville, N . C. tfn EX EC U TR IX NOTICE N otice is hereby given that M ary Lelia H opkins has this day qualified as ex ec­ u trix o f the Last W ill and Testam ent o f A lice M artin H opkins, deceased, lute o t the C ounty of D avie and State of N orth Carolina. A ll persons having claim s against said estate w ill present tem . du ly verified, to M ary Lelia H op­ kins, at her hom e on M ocksville, R oute 3, on or before the 26th day o f N ovem ­b er, 1954, or this notice w ill be pleaded in bar o f their recovery. A ll persons in­ debted to said estate w ill please m ake im m ediate settlem ent. 11 20 Ctp T his the 19th day o f N ovem ber, 1953. M A R Y L ELIA H O PK IN S, execu trix of A L IC E M A R T IN H O PK IN S, deceased. . NOTICE OF ADM INISTRATION N otice is h ereby given that the under­ signed, J. K . M eroney and H elen M. Me Bee, have this day qualified as ad­m inistrators o f Em m a K . M eroney, de­ ceased. AH persons holding claim s against the said estate w ill present them to J. K . M eroney, 437 Salisbury Street, M ocks­ ville, N. C., du ly verified, on or before the 2nd day o f N ovem ber, 1954, o r this n otice w ill be pleaded in bar o f their recovery. A ll persons indebted to said estate w ill please m ake im m ediate settle­ m ent. 11 5 6t T h is 2nd da y o f N ovem ber. 1953. J. K . M ERONEY HELEN M. M cBEE A dm inistrators o f the estate o f Em m a K . M eroney.R ob ert S. M cN eill, A ttorney. EXECU TO R’S NOTICE N otice is hereby given that A gnes S. Sanford and John S. Sanford have this day qualified as ex ecutors o f the L ast W ill and Testam ent of John C. Sanford, deceased, late o f the C ounty o f D avie and State o f N orth Carolina. A ll persons having claim s against said estate w ill present them , du ly verified, to A gnes S. Sanford, at her h om e on South M ain Street, M ocksvillc, N. C., on or before the 2nd day o f N ovem ber, 1954, or this notice w ill be pleaded in liar o f their recovery. A ll persons in­debted to said estate w ill please m ake im m ediate settlem ent. 11 5 CtT his 2nd day o f N ovem ber, 19S3. AG N E S S. SAN FO RD JOHN S. SAN FO RD E xecutors o f John C. Sanford, deceased R ob ert S. M cN eill, Attorney. ASC. News (PMA) 1053 ACP Program The 1953 Agricul'ural Conser­ vation Program year has been extended to December 31, 1953, due to the extreme weather con­ ditions. Farmers who have been grant­ ed aprovals for lime or fertilizer materials whch they have been unable to carry out to date, may still request Purchase Orders for 'hese materials if they find that they can use these materials be­ tween now and December 31. Practices already performed under the 1.953 Agricultural Con­ servation Program should be re­ ported right away, but in no event later than Jan. 15, 1954, in order to qualify for payment. ACP PROGRAM IS ANNOUNCED Davie County farmers are co­ operating wi!h the Federal Gov­ ernment in an effort to conserve our soil and water resources ac­ cording to O. E. Driver, Chair­ man County ASC Committee. November 6, 1953, was the initial closing date for farmers to re­ quest Federal Cost-sharing un­ der the 1954 Agricultural Con­ servation Program. 017 farmers have indicated their intention to cooperate in the program. These farmers requested $122,543 Feder­ al Asistance says Mr. Driver. The County was allocated only $38,- 933 to be used in sharing wth the farmer part of the cost of carry­ ing out needed conservation prac­ tices. Mr. Driver points out that the establishment of legume and grass vegetative cover as a part of land-use adjustments and initiat­ ing systematic crop rotations is an important part of tho 1954 ACP. Federal cost - sharing on ■•eed, lime, and commercial fer- lizers essention to es'ablishment of permanent protective cover is provided for in the program. Farmers requested more assist­ ance for establishing permanent pasture on non cropland than for any other prae'iee. The other practices are listed in the order that was requested most: Initial establishing of Red Clover nnd Alfalfa and Crop’and, Using lime on cropland, Improving per­ manent pasture, Terraces, Open ditch Drainage, Winter Cover Crops, Thinning (Trees, Contour Stripcropping and Planting Trees. "Some of (he farmers Who have been given approvals will prob­ ably not be able to carry out the practice (s) by the the date specified by the County Commit­ tee and the money set up for these practice'? will be returned to the County Pool,” he said. “The Coun­ ty Committee has decided that they will accept farmer’s re­ quests for cost-sharing through­ out the program year, and re­ quests filed will be accep'ed and given consideration, to the ex­ tend available funds perir>’t, at each regular monthly meeting of the County Committee.” All farm- mers may file requests with the County Commi'tee at the County ASC (PMA) Office which is lo­ cated at Mocksville. Requests for cost-sharing under the 1954 ACP may .be filed during office hours Monday through Friday. The County office is closed on Satur­ days and on Holidays. V i PRICE SALE N OW . . . you can g «' TWO (regular $2,95 each) VENIDA "H ang O v«r" Hanger*, designed to conform lo your everyday dressing habit*—coat first then trousers— tor the price o t ONE . . . PLUS o BONUS GIFT o f a sturdy pair of canvas sole, terry cloth slippers! These beautiful hangers are m ade of durable cellulose plastic with an attractive walnut finish—an unusual life­ time convenience for men and wom en! Individually pack* p g ed in a colorful picture bo*—on Ideal glftl VENIDA MAKERS or FAMOUS VENIDA HAIR NETS Vtnidq Products 119 West 40ih St.. Ntw York 18, N. Y. -------- fn d oitd it my chtck or money order for $2.93. Send me the 2 Venida "Hana O v.r” Hangars PLUS your Sptciol Bonus Gift of 1 Pair of Terry Clolh Slippers. Cheek SMpptr Size Q (Small) Q (Medium) Q (large) NAME______________________________ ___________________________________________________ ADDRESS________________________ - ________________________________________ CITY— _________________ZONE -STATE- UNLIMITED NOTICE OF ADM INISTRATION N otice is herby given that the u nder- \ signed, J. K . M eroney and H elen M . M c- B ee, have this day qualified as adm in­ istrators c.t.a. o f C. F. M eroney, Sr., de­ ceased. A1J persons holding claim s against the said estate w ill present them • to J. K . M eroney, 437 Salisbury Street, < M ocksville, N. C., du ly verified, on or b efore the 2nd day o f N ovem ber, 1954,' or this notice w ill be pleaded in bar o f their recovery. A lll persons indebted to said eslate w ill please m ake im m ed­iate settlem ent. U 5 Gt > T his 2nd dav o f N ovem ber, 1053. j J. K . M ERONEY I HELEN M . M cBEE I Adm inistrators c.t.a, ot the estate of C. F. M eroney. Sr. R obert S. M cN eill, A ttorney. cr MOREHEADi- OIT<Y EXEC U TR IX NOTICK N otice is hereby given that F lorence S. Leonard has this day qualified as • executrix o f the Last W ill and Testn- , m ent o f W« A . Leonard, deceased, late t o f the County of D avie and State o f- N orth Carolina. A ll persons having claim s • against said estate w ill present them , ! du ly verified, to F lorence S. Leonard, a t 1 her hom e in A dvance, N. C., on or before D ecem ber 10. 1054. o r this notice w ill be pleaded in bar o f their recovery. All persons indebted to said estate w ill please m ake im m ediate settlem ent. This the 23rd dav o f O ctober, 1053. FLORKNCE S. LEO N AR D . E xecutrix of W . A . Leonard, deceased. 12 10 fit ADM INISTRATOR'S NOTICE N orth Carolina—D avie County T he undersigned, having qualified as Adm inistrator o f the estate o f J. D. C ook, deceased, late o f D avie County, this is to n otify all persons having claim s ngalnst said estate to present them to the undersigned on or b efore the 4th day o f D ecem ber, 1954, or (his notice w ill be pleaded in bar o f their recovery. A ll persons Indebted to 6aid estate w ill please m ade im m ediate paym ent to the undersigned. 12 3 Otn T his the 1st day of D eem ber, 1953. W . B. REN EG AR, A dm inistrator ^ R . B. SAN FO RD , Jr., A ttorney. * Sth& . [fr y NORTH CAROLINA OPENS THE DOORS W o r ld T r a d e ! Now North Carolina can boast tho most modern marino shipping facilities on the At­ lantic seaboard, for at Wilmington and More* head City, two deep water sea ports hava been developed by a $7,500,000 state pro­ gram. The savings in overland froight rates' and the opening of these two doors to world trade will contribute greatly in making North Carolina a better place in which to work, play and live, Anotaor contributing factor to more pleaianf living for North Carolinians is the brewing industry's self-regulation program where brewers, wholesalers and retailers—in coun­ ties where malt beverage sales are permitted under state control—cooperate to maintain wholesome conditions for the legal sale of beer and alb. North Carolina Division UNITED STATES 8R5WKF.S FOUNDATION, INC. C. J. ANGELL APPLIANCE COMPANY iAfatfiaq SALES & SERVICE Phone 259-J WHEELS ALIGNED By the BEAR System For Safe DrivingROBIE NASH 1819 S. Main St. Phone 650 | SALISBURY, N. C. How To Relieve B r o n c h i t i s t Creomulsion relieves promptly becaust it goes into the bronchial system to help loosen and expel germ laden ihlegm and aid nature to soothe and ,ieal raw, tender, inflamed bronchial membranes. Guaranteed to please you or money refunded. Creomulsion has stood the test of millions of users. CREOMULSION relUvtt Coughs, Chert Coldi( Acuta BroftcMfia T o R e lie v e ^ M is e r y Q T c f i f i UQUID OR TUICTS-SAME ,AST MUI, ROWAN PRINTING CO. Hhone 532 - Salisbury. N C One of the largest printing and oirlce supply honsM In the Carolina* • Printing • Lithographing • Typewriters • Complete Office Supplies Don't Fool With A CHEST COLD TWs PROVEN Way Relieves Distress— Breaks Up Local Congestion! Rub "on highly medicated, concen­trated Musterole. It promptly relieves coughs and breaks up local conges­tion. Musterole creates protective warmth on chest, throat and back, assuring amazing long-lasting relief! MUSTiROLE SHOAF COAL AND SAND COMPANY Depot St. Phone 194 rnttcxiPTio* »• AN D COUGHS DUE TO COLDS SIMPSONS S C Rn®ais^®iS!E3ia&!H=f« AUTOMOBILE SAFETYGlass & Mirrors Installed —Ail Models—ROBIE NASH 1819 S. Main St. — Phone 650 Salisbury, N. C. SHOAF COAL, SAND & STONE ww,Mown.— Prompt Delivery — ilkm> Drtiy Co i'huiu* 21 Phone 194 Use Au Kmerprise IV anl Ad . . . TAYLOR MATTRES­ SES ore so soft and. com­ fortable! Every bed should have one of these QUALITY MATTRESSES. T h e TAYLOR MAT­ TRESS COMPANY in­ vites you to come in and see the most popular MATTRESS . . . TAYLOR MATTRESSES. When you want the best for less In sleeping comfort buy a TAYLOR MATTRESS. See your focal FURNITURE dealer for Information on TAYLOR MATTRESSES.• * Taylor Mattress Co. SA LISBU RY, N. C. For Dogs ond Livestock SEVERE MANGE. ITCH, FUNGI, BARE SPOTS AND MOIST ECZE­ MA (puffed, moist ears and feet). Bar torenett, ear mites, puss pim­ ples and other sltio irritations. Pro­ motes healing and hair growth ot YOUR MONEY BACK. //c fy h t/fc WILKINS DRUG CO. PHONE 21 MOCKSVILLE IT PAYS TO ADVERTISE , v . v a v m v ^ v a v . v . v , % v . ^ w m v i a % % w l ™ w CUSTOM BUILT Venetian Blinds - Aluminum Frame Screens - Aluminum Awnings - Ornamental IronSalisbury Venetian Blind Manufacturing Co. Statesville Road Phone 4319 S a lis b u ry , N. C. W WVUVWVWVUVWWUWWVWVS^W/VWtfWYVUWUWWWWVS V A W .V .W .V .W ,V \ V .,A W /J W W W W /M \ W V W A M f t f e l l &u!horized Cadillac - Studebaker Service Performed by Factory-Trained Mechanics T O E E J L A J H U E I Baked Enamel C hecking AUTO PAINTIFG i/M w U S T I N G A1] Type Vf|EPAfRIIIG I BODY WORK Drive In Soon For That Fall and Winter Check-Up 24-Hour Wrecker Service Day Phone 14 — Night Phone 720 ® I Hedrick Auto Co., Inc. Your Cadillac and Studebaker Dealer PHONE 14120-122 N. Church St. Salisbury, N. C. ;! .V ,V .- .W .W .W . V A W W . V A W .W ,V A , .W .V ^ W V W D I R E C T O R Y o f D e p e n d a b le B u s in e s s a n d P r o fe s s io n a l S e r v ic e D R U G S D R U G S .D R U G S T h e B est in D ru gs and D ra g Service. P rescrip tion s A ccu ra tely C om pou n ded Hall Drag Co. P hone 141 M ocksville STATIONERY AND JOB PRINTING W H A T E V E R Y O U R P R IN T IN G N E E D S— W E C A N D O T H E “ JO B ” T O Y O U R C O M P L E T E S A T IS F A C ­ T IO N . W e R epresen t LE E SO U T H E R N E N G R A V E R S THE MOCKSVILLE ENTERPRISE F lour, M eal, Feed S tu ff and G rain J. P. Sresn Milling Co. P h one 32 N ear D epot M ocksville # P ure C rystal Ice 9 C oal for G rates, Stoves F u rn aces an d S toksrs Mocksville fee & Fuel Go. P h on e 116 £ C h rysler - P ly m ou th SALES & SE R V IC E # In tern a tion al T ru ck s Davie Motor Company Phone 169 Mocksville [ WHAT'S YOUR PROBLEM? J v ■■ 11 j /----------------------------------------- The business firms listed in this directory can be depended upon to solve any problem in their field. No matter what your problem might be — you may find the answer here. Lum ber, G eneral B u ildin g Supplies, S h cctrock , P laster Smiih-Dwiggins Lumber Co. PIIO N E 233-J Salisbury H ighw ay QUALITY DRY CLEANING & LAUNDRY MOCKSVILLE LAUNDRY PIIONE 190 PAGE TWELVE THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 10, 1953 Tid-Bits By GORDON TOMLINSON The now neon sign installed by C. C. Sanford Sons Company has a tendency to lend itself to thc Christmas atmosphere, At night time it is very attractive. Attendance was very slim at civil court the first two days this week. The reason is probably; due to the slow and tedious pro­ cedures that usually marks civil, action. As one attendant put it: “fTheyi spend nil day presenting evidence! and arguing back and forth on a , case, then the lawyers go off in j a conference and settle the entire | matter.” And that seemed to be the way most of the cases were going, too. ■ Judge Dan Moore advised in one case that the parties get to­ gether and try to settle it before the.May term of civil court. Said the Judge: “I understand that this case involves 100 wit­ nesses and only $92. I don’t think it is worth the time and expense of the court.”Dr. and Mrs. Lone Are Hosts At Dinner ' Dr .and Mrs. W. M. Long were hosts at a dinner recently at their i home on .Salisbury Street. j ’ Covers were laid for 23 mem­ bers of Dr. Long’s family. ; CARE is so widely known in Berlin that when trolley cars ap­ proach the intersection near its Mission office the conductors skip the street name and call out, in­ stead, "CARE stop.” Woman’s Club Meetine Held In Cooleemee The Cooleemee Woman’s Club met Tuesday evening at the home of Mrs. George Apperson. Mrs. John Barber, president, presid­ ed. At the business session the members voted to send the Chil­ dren’s Home in Greensboro a do­ nation of ten dollars. The program chairman, Mrs. Ed Usury, inlroduced Mrs. J. Wen­ dell Klein who read “Once on a Christmas.” Mrs. J. G. Craw­ ford read “The Christmas Story.” She- was assisted by Mrs. Usury who played Christmas music on the phonograph. The program closed with a recording of the “Lord’s Prayer.” The hostesses, Mrs. George Ap­ person,. Mrs. E. C. Tatum and Mrs G. Gobble served cake and cof­ fee to-the members present. iTiny red candles in marshmallows carried out the festive motif. Mrs. Leon White Honored At Shower Mrs. Sallie Branson, Mrs. S. A. Bailey and Mrs. W. O. Cojien entertained at a miscellaneous shower last Saturday evening at the home of Mrs. Branson compli­ menting Mrs. Lfcon White, bride of October 24, the former Miss Nancy Joan Cohen. Bridal games and contests were played arid prizes awarded the winners. The honoree was pre­ sented a > shower of lovely gifts. Iced drinks, candy, fruit and nuts were served to: the honoree and mesdames Parry Wyricks, Kennetl/ Bailey, Nora Riddle, Ruth Vickerson, Geniver Shoaf, John Grimes and Sylvia Driver. Use An Enterprise Want Ad Barbara Ann Douglass Weds Zaro E. Foster Mr. nnd Mrs. Zaro Elton Foster are on a wedding trip to Ruidoso and Cloudcraft, N. M., following their wedding which was an event of Thursday, Nov. 26. Mrs. Fos'.er is the former Bar­ bara Ann Douglass, daughter of J Mr. and Mrs. Dale A. Douglass,1 Ranch Rd., Big Springs, Texas. The bridegroom’s parents are M r/ and Mrs. R. C. Foster of Har­ mony. The Rev. Jordan Grooms, pas­ tor of the First Methodist church, read the vows at an informal double-ring ceremony in the liv­ ing room of the parsonage before members of the immediate fam­ ily. The bride, given in marriage by her father, wore a brown suit with rhinestone trim. Her hat was a French design of honey fur felt. Her accessaries were of liz­ ard. Judilh Dale Douglass, only sis­ ter of the bride, was her attend­ ant. Mrs. Foster is n graduate of Big Springs High School and McMur- ray College in Abilene. At the la:er she wa£ a member of Delta Beta Epsilon, the McMurray Theater, Alpha Psi Omega and Wah-Wah Tassee. She has taught in the Plainview High School. The bridegroom is a graduate bf Harmony High School and Duke University. He was a mem­ ber of Sigma Phi Epsilon and Al­ pha Kappa Pai. He was employed by the L. B. Price Mercantile Co. and Ernest & Ernst in Winston- Salem, until he entered the Air Force. He was recently stationed at Webb Air Force Base. MORE ABOUTDr. Connell torate he served as pastor of a Baptist church at Jeiferstown, Ky. and helped the congregation con­ struct a large limestone church building. During World War II Dr. Con­ nell served as a.chaplain in the Army. He performed two tours of du'y in the South Pacific nnd once was returned to the Stales for hos­ pitalization after contracting a disease there. He held the rank of major in -the Army Reserves. Dr. Connell served as a pastor of Baptist Churches in West Con­ cord, Boonville, and Jonesville, beffore World War II. He accepted ihe pastorate of Courtney Baptist Church, formerly Crosroads Bap­ tist Church, after receiving his iTh D from the seminary. | He was married to the former Miss Beulah Corn of Kannapolis.' She survives. , j 0 ;her survivors include one sis­ ter, Mr*. Millard Cheek of Kan­ napolis; three brothers, Morris and Carl C. Connell of Kannap­ olis and Dowd, Connell of Rich­ mond, Va. MORE ABOUTEscaped Convicts r.tation. ■ Mayc is from Charlotte and iff serving 7 to 10 years for armed robbery and two years for car theft. Dowd is from Southern Pines and is serving 3 to 5 years for- breaking, entering and larceny. ^3i3i3t%S!%3iS;Si9lSl3l3i3lSl3l3l%3iai3l3-,Si»i3l3iSl3i3l3i3l3iaia-.Sl9:3i3)3lSlSl%3)3i%SlSl|fJ. N. “SCOOTER” McDANIEL Says:- “You cannot go wrong by taking your Clothes to Wade’s Dry Cleaning Depot Street Mocksville, N. C. BI IS lEtg'e’gtg'c’e'C'.eie'e'e’cts’ssex'.c-s'.ete'-s'c B O IL I T - B R O fI I T -F R Y I T -R O A S T I T !3% / | & - I (BED TRUCKS Sanford Motor Co.PHONE 77 MOCKSVILLE, N. C. MkS)3l»iai9)9i»3i3l3ia3!3i3l3t3i3ia3i3iSi3l3lS)Si3lk3i3;3l3iStaSl9lSg3iaxaai9i3)a>iaM best to | Picnic Hams 14-6 lb 43c lb BAR-B-CUED Spare Ribs 89c lb £ 3 lbs., 89c « ■ 1 WATAUGA CHOPPED 1 Kraut 303 can 12 c fX -_______________________—------—--------------------K K n K K w w w w w w w w w w w w w w w w w w iew iew w ^ isieieisieifta a roa sisisisja jsja ix a a ijiM iS isoisa iS iS ijiM TOPS IN FLAVOR—CHOICE WESTERN Chuck R oast 4 5 c I, 39c lb 79c lb 39c lb TENDER LEAN FRESH Ground Beef LOIN CUT Veal Chops LOTS OF HEALTH Beef Liver FINE FOR SEASONING Salt Pork 8i9:3>2i9>*9>9i9i9iaiBi3>9s%3;:M>>MiSi>;*ia9i9i:>ia)a)%9g3]3iS}2:9)3)3!9;Sg3i3i9s9i:<!ciC!e!cw«te«te«‘S 'c > r e ie « w w w « i«MERITA HOLIDAY Ming Tree Gardens Find the Finest, Freshest FLOWERS in our choice YULE SELECTIONu j Dish Gardens | Begonias Door Decorations CyclamensMums Corsages Wreaths Davie Florist i Phone 222W Wilkesboro St. RED CROSS BRAND Pinto Beans .. ^ 303 cans OLD. BLACK JOE DRIED NO 2 CAN W W < W < W W W W < W W W W W W W W W W < W W I I Blackeye Peas 14c 24c lb BUSY-DMT D essert JELL-0 U^Vfc\POOOINGS 2 for 21c isisiaigigbgieieieigisigisiaisisiaieistaiesgie’-aisisisieigieisieicisisie'e^tsx's^isigtgigigigigieisssiefetsieisieigecietefsisegigssieteteieistg ft TIIIN SKINNED SWEET| ORANGES ....... 5 lb. bag,. 33c § JURIBO BUNCII FRESH£ COLLARDS...........23c each % NO. 1 STEWART LARGE| PECANS .........1 lb9tgigistststsis'e'ewwieisistgicteisigieteisieisisisie*!!®8 STAYMAN WINESAPFANCY APPLES...5 lb. bag, 63c GARDEN FRESHMUSTARD SALAD ...2 lbs., 29c [MEDIUM SIZE YELLOWpkg., 35c ONIONS ............ 3 lbs., 19c 3 small 23c 4 tall 53c Fruit. Cake 4 lb cake $169 Regular $2.00 value aaiasiasiasiaasiSiSiBiaai&aasiSiSiaiSi Mixed Fruits LEMON — ORANGE— CITRON­ S'»vVifwWmvif st v w &PINEAPPLE |—CHERRIES, Diced. J v■9% sr53c lb isi£te!eie!gis-€<gtsisisis«isi«iff.iei«iaiete!ets«nsis!5i«!g!e(ei6ieis!ctcieigieie<«ieis!eiste!eisic*s!e!c««ts!ei®i€!sicieici€!etetc'<:igtg«ieig«eic!e:ieis!««!eig!«!eiei«<e!«« Large29c Little Jewel 5 Strand BROOMS $1.03 oz bottle w hi it30c C L O R OX Quart, 18c TexizeCLEANER Qt. bottle, 67c 2 regular bars 21c Quick Elastic powder STARCH 8 oz. pkg,, 14c tsisigteietfiisie^w^^^wwise^ieicwsiSfc’^ ^ ^ ’e ^ ’efc^wte^isigtess^^ie^te^ieaaaaaaaaaaaaa^Aaaia& aaaaaaiaaaasiasiaaiaai& aaasiaa& aaaiaassSj& aa& aasas! % ■ H e f f n e r & B o l i c k G r o c e r y - ' S U P E R M A R K E T UJ€ 01 CR€€n 5Tftm P5 I I V vg 9V ■■ p f 1I KI w j IIW W W W W W W W W W W W W W W <M W <W W W W W W <W W W W W W W W W M W W W W W W W W <W W W W W W W W W <W W W W W W W W t .««««« remgMWWWWOKWWWW WWWW<WWW<<W<WW<<WWWW<WWWWWW<WWWWW<WWWWW<<WWW<WW<<WW<W I VOLUME XXXVI All Thf lioimty News For Everybody’ MOCKSVILLE, N. C., THURSDAY, DECEMBER 17, 1953 <AU ’iiw Uouiily News *or liverybuciy”No. 43 ITEMS STOLEN from Davie County business firm by Johnny Bailey are inspected by. Sheriff Alex Tucker and Deputy Milliard Godbey. These items were recovered as far away as Cherokee County. Bailey Admits Breaking Into 19 Places In Davie Reward Offer Leads To' Breaking Robbery Wave By GORDON TOMLINSON 1953 had been here only seven days when Pennington Chevrolet Company was broken into. A lock on the back gate was broken, a section of the rear window re­ moved, and entrance into the building was made. Once inside ' the safe ' door was forced open and between $100 and $150 in cash was taken. Also some stamps and possibly some automobile parts were taken. This robbery marked the be­ ginning of an epidemic of break- ins that was to exist for the next ten months. Break-ins that were to keep local officers on the go, night and day — checking all types of leads, most of which turned out to be false. On Jan. 15, two more firms were •' entered. Miller - Evans Hardware was entered by forc­ ing of a rear door. Stolen was a .22 calibre pistol, a 30-30 rifle, a drill set, and a crowbar. A pack­ age of sandpaper was torn open and strewn around the room. A knife was thrown into a door and a stack of roofing. Also this same night the Mocksville Flour Mills was entered through the prying open of the office door. Once in­ side considerable rummaging was - done through the desk drawers, but only an empty money bag was reported missing. Then on or about Sunday, Jan. 25, “Pop’s Barbecue' was broken into. On Feb. 11 "Buck’s” Bar­ becue was entered and approxi- . mately $225 stolen from the picco­ lo. On or about Feb. 12, both of these barbecue places were again (Continued on Page 6) Toy Show Saturday The annual “Cartoon Carnival” show for the benefit of the under­ privileged children of Davie County, will be held Saturday morning at the Princess Theatre. Although children are expect­ ed to make up bulk of the au­ dience, all ages will be admitted with the donation of a new toy. Doors will open at 9:45 a.m. Mr. and Mrs. Frank Fowler have announced that the following will be shown: "Spooky-Wooky,” "Mush and Milk,” ‘’Hook, Line, and Sinker,” “Rabbit F ir e ,” 11 Jerry and the Goldfish," “Lunch With a Punch,” "Moose On The Loose," and possibly others, ■ All toys collected will be turn­ ed over lo the Mocksville Junior Chamber of Commerce to supple­ ment the results of the bundle drive held this past Sunday, These items will be turned over to the Welfare Department for distribu­ tion among the needy ■ of Davie County. * i JOHNNY BAILEY . . . admits breaking into 19 places in Davie County during the past year. Officers Nab Youth For Stealing Gar Davie County officers recovered a stolen South Carolina car last week, and arrested Ilugie Jackson Lawson, 17, of Rt. 1, White Horse Road, S. C., and charged him with the theft. The abandoned automobile was recovered Wednesday night, Dec. 9, just off the Yadkinville high­ way near the city limits of Mocks­ ville. It had been abandoned af­ ter running out of gasoline. On Friday night, Deputy Sher­ iff Ransome Cooke, Deputy Mill­ ard. Godbey-and Highway Patrol­ man T. J, Badgett arrested Law­ son on the Bear Creek Road, Lawson had been visiting some friends in this area. Lawson told officers that he stole the 1940 Ford from a park­ ing lot near Greenville, S. C. Driving the car, he headed for North Carolina. At Kings Moun­ tain he gave out of gasoline and worked at a service station long enough to secure money with which to buy some gasoline. The FBI was called in on the case inasmuch as, Lawson was charged with transporting/a stol-j. en car across the state line. Law­ son Was taken into custody at the local jail Saturday afternoon by FBI Agent Marshall and U. S. Commissioner Ader of Winston- Salem. He will be tried in Federal Court in Winston-Salem. 18 PAGES THIS WEEK • -Your Enterprise this week con­ tains 18 pages of news and adver­ tising of interest to the people of this community. This is the larg­ est regular edition of a news­ paper ever published in Davie County, (Enterprise Photo). Holiday Schedules Are Announced Many of the Mocksville stores are remaining open each night until Chlistmas for shopping con­ venience. The stores will close at the cessation of business on Dec. .24, and will reopen on Monday, December 28. The schools of Davie County will close at 12:30 Friday and will reopen on Wednesday, Dec. 30. Heritage, Inc,,, will close out their work .activities, on Friday with .,a: Christmas party featuring barbecue and entertainment. The event will be highlighted by pre­ sentation of fruit and nuts treats to the employees. The plant will reopen Monday, Dec. 28. The Mocksville Flour Mills, Inc., will, close on Wednesday, Dec. 23, and will reopen on Mon­ day, December 28. Green Milling Company will close on Thursday, Dec. 24, and reopen on Monday, Dec. 28. Hanes Furniture Company will close Tuesday and will reopen on Monday. The county offices arid library will; be closd Dec. 24, 25 and 20. Tlie, Davie County Draft Board office .will be closed December 2 through'Dec. 26. s CROP Drive Ecackcs$880 The'D a v i c County CROP (Christian Rural Overseas Pro- grom) , drive/lias reached a total of, $880.15. Paul-Richards, chairman of the drive’-'for Davie County, reports that this exceeds the 1952 drive by approximately $100. Mr. Richards expressed his ap­ preciation to all those who partic­ ipated in the drive. He requested that any of the workers that have not yet reported to do so just as soon as possible. Town Adds New Officer John Smith has been added to the Mocksville Police force as an sxtra night policeman. Mayor John E. Durham an­ nounced that Mr. Smith had been serving on special duty since his appointment by the Town Board on Nev. 15. The appointment was kept secret at the time in an effort to apprehend the party who was breaking into the var­ ious establishments. It was announced that Mr. Smith would continue on the force as an extra policeman. llsfi An Enterprise Want Ad - The Enterprise Will •Publish Elarlier Next Week For Christmas The Mocksville Enterprise will be published and mailed on Tuesday of next week. This wi’l put the newspaper into the hands of subscribers on Wed­ nesday. This will make it necessary for our advertisers and corrcs- pandents, as well, as other news sources, to. get tlieir copy in on Monday. Copy or advertising after Monday will be too late. As lias been the custom of the Enterprise for many years, we will omit the .issue of Dec. 31 in order that the employees of the paper man enjoy the holidays with their families and friends.’ Davie County . Schedules Many Christmas Activities Various church ai.d organiza­ tions reporting plans for special Christmas programs to us are as follows: • First Methodist The traditional candlelighting service of the First Methodist church, Mocksville, will be held Sunday, evening at 7:30 p.m. The choir will present a Christmas cantata, “The Song of Christ­ mas,” following which the con­ gregation will participate in the candlelighting service. Mrs. J. K. Sheek will serve as organist. Baptist Church ' The Junior choir of the First Baptist Church will present a Christmas program on Wednes­ day, Dec. 23, following which a Christmas tree with gifts will be held for the Sunday School. Presbyterian Church A Christmas cantata, “Music of Bethlehem,” by Fred B. Holton will be presented by the junior and senior choirs on Wednesday evening, Dec. 23rd at 7:30 at the First Presbyterian Church in Mocksville. The cantata is di­ rected by Mrs. J. S. Sanford and Mrs. L. G. Sanford. Hugh-Larew will serve at organist. The chil­ dren's dividon of Sunday School will present a program on Tues­ day evening. • Bixby Presbyterian A special Christmas program will be presented at the Bixby Presbyterian Church on Sunday evening at 7:30. Jaycee Kiddies Party On Thursday night, Dec. 17, the Mocksville Junior Chamber of Commerce will be host to around' 70 children at their an­ nual Christmas, party at the Ro­ tary Hut. These children will be escorted to the program by the Jaycees, entertained, served re­ freshments and receive gifts and treats from Santa Claus. Rotary Club The annual Christmas party and family night of the local Ro­ tary Club will be held at the hut on Tuesday night, Dec. 22, Plans Outlined For New County Office Building Pfc. Grady Whitaker Serving In France at 7 p.m. i Fork Episcopal The schedule of activities and services at the Episcopal Church for next week" is as follows: Wednesday nighty Dec. 23, 7:30, a pageant "The Light of Men” will be presented in the church followed by the children’s party in the Parish House. Thursday night, Dec. 24, at 7:30 will be the annual caroling which will be followed by the YPSL party in the Parish House. On Christinas morning at 9:30 the Holy Communion Service will be celebrated by the Rev. L. G. Roberson, Priest in Charge. Turrentine'Baptist A Christmas Pageant, “‘No Room In The Inn,’ will be given Sunday night, Dec. 20 at the church at 7 p.m. On Thursday night, Dec. 24, a children’s Christ­ mas program. will be presented. Concord Methodist The Concord Methodist Church will have their Christmas service on Thursday, Dec. 24, at 7 p.m. The program will consist of the children’s and young people’s “Service of Lights." Mocks Methodist A Christmas pageant, The Na­ tivity, will be presented here on Thursday evening, Dec. 24, at 7:30 and the public is invited to at­ tend. Center Methodist The children’s Christmas pro­ gram and candle lighting service will be held at the Center Metho­ dist Church on Sunday night, at 7 p.m. . • School of Dance The Raver Schol of Dance will present their annual Christmas program at the Rotary Hut on Monday afternoon at the Rotary Hut. Only the parents are invited. Macedonia : Moravian The. Macedonia Moravian Church will hold their Christmas Love-feast and. Candle service, Sunday night, Dec. 20.at 7:30 o’­ clock. . (Continued on Page 4). Pfc. Grady L. Whitaker, above, is stationed on the U. S. SI Ben- ington. He has visited Cuba, Ice­ land, Turkey, Italy and is now in France. "• ' He entered the Marines. - May 27, 1952, and received-)'his'.basic training at Parris Island,' S.' C. He is the son of Mr.- and Mrs. W. IC. Whitaker of Mocksville, R.t 2. He is married to the., for­ mer Lois Fay Collins of Smith Groye. B. C. Clement Rites Held Funeral services ‘ were' ‘1 held Wednesday afternoon at the horne for Baxter Clegg Clement, 621 Rev. W. Q. Grigg and Rev. E.. M.'Avett officiated. Burial was 'in Rose Cemetery. Mr. Clement died suddenly • of a heart attack at his home.while preparing to go to bed^ He .had been in declining health for'the past four years. He was the son of the late Dr. B. C. Clement and Mrs.. Lina; Bar­ ber Clement. He was born in MocksvUle on Feb. 8, 1891. He was married to Miss Annie Lucky Allison on May 24, 191-7/ She died in December, 1936. Mr. Clement served as Regis­ ter of Deeds of Davie County from 1930-1932. He was associat­ ed with the North Carolina De­ partment of Revenue at the Win- -ton - Salem office for 16 years, retring in 1949. For the past two years he has been associated with the Mocksville Insurance Agency. He is survived by one son, B. C. Clement, Jr., of:'Lexington, Kentucky; one daughter, Miss Ann Clement of Lexington, Ky.; and one sister, Mrs. Sam Hines, of .Winston-Salem., Pallbearers were John Durham, A. M. Kimbrough, Jr., E; C.- Mor­ ris, Jack Sanford, Dr. -G. V. Greene, and Chirles Hines.; ' IT PAYS TO ADVERTISE ' " ' \ A* '* \ j ' " v " . 'nI*• ■ ... a/ d ^ »V. ^ - -sVS? Architect's sketch of the new Davie County office building. ' . . M .:' Construction Bids To Be Opened Thursday Bids for construction of the Davie County office building will be received at the courthouse in Mocksville at 2 p.m'. on Thurs­ day.' Lashmit, James, Brown and Pollock of Winston-Salem .are ar­ chitects and engineers for the building. Tho building will be a three- story structure on the property south of the court house. It is designed for fireproof construc­ tion throughout with reinforced concrete floors and roof. Walls will be brick outside and cinder blocks inside. There will be metal stairs ,metal door frames, metal sash, asphalt tile floors and acous­ tical ceilings. iThe only wood in the building will be office doors. The main entrance feature will be of limestone. The. first, floor will house the welfare agency, health depart­ ment, and library. & separate entrance on the south side street will give a direct access to a common waiting space for the welfare and health offices. Wel­ fare facilities include offices for the supervisor a secretary, and two case workers. In the health department are the office and' ex-’ amining room for the doctor and offices for a secretary and sani­ tarian. . The library, with a capacity of 10,000 volumes (including the bookmobile) has its own entrance on the side street also. Space is provided for reader seating at tables . and in informal lounge seating. A work room, adjoining the building’s loading platform will facilitate the servicing of the bookmobile. The second floor is entered from the main street on the west side. The farm and home agencies are on this floor .with offices for the farm agent, and assistant fam agent, the home agent, soil conservation, artificial breeding, mimeograph work and secretar­ ies. There are storage rooms for supplies. The home agent has a complete­ ly equipped laboratory for dem­ onstration work. A unique feature of the sec­ ond floor is the arrangement of two large committee rooms, and the home agent's laboratory With folding partitions permitting the joint use of various combination • of spaces by various groups or a combined use of all three spac­ es with a seating capacity of ap­ proximately 110 persons. The third floor is assigned to the county school supt., the Farm Home Administration, and , the Agricultural Stablizntion a n d Conservation Administration, for­ merly known as the PMA. The school superintendent has a large office suitable for small conferences, a large general work space, two supervisors’ offices, a secretaries’ office and a mimeo­ graph room. FHA will occupy, a single office. ASC has a large general office, two consultation offices and a supply room. Each floor is provided with toilets for men and women, a janitor’s closet and a drinking fountain. Telephone booths for the convenience of the public will be installed on the first floor. A mechanical room in the base­ ment will hou^-e the electric ser­ vice and heating plant. Lighting will be- by modem fluorescent fixtures designed for an illum­ ination level of 25 foot candles. The heating system will be a forccd circulation 2-pipe hot wat­ er system using copper convectors at heating elements, According to the architects, thd building is conceived as function­ al and businesslike with the ac­ cent on sturdy, serviceable ma­ terials. An example of the functional concept is the inclusion of canti- levered concrete sunshades over all viitjdows on the west, south >ncfeast facades. PAGE TWO The Mocksville Enterprise P u blished E very T h u rsd a y a t M ocksville, N orth C arolin a MR. AND MRS. EUGENE S. BOWMAN...............................Publishers GORDON TOMLINSON.....................................................................Editor Entered at tha Post Office at Mocksville, N. C., as Second Class Matter Undei. Act of Congress of March 8, 3879 ^JQagsari'r.TLT^*/Nnrth Carolina ^PttrS S ASXKlATtCAVl Process of Law Several years .ago .an FBI agent spoke to the Mocks­ ville Rotary Club. IFhis^FBI man revealed that the work of the Federal Bureau, of .Investigation was not all exciting and glamorous. He toldcofhow often it was necessary to stand for eight or nine hours in the rain or bad weather watching a suspect. He vtold of doing without sleep or without sating while seeking; out evidence in a case. This FBI agent .emphasized that catching the crim­ inal might ibe more glamorous from the standpoint of the public, nevertheless, the ^gathering of evidence to support the charge was of equal .importance. “This iis the side ol Jaw ( enforcement work that the public knows .little or nothing&b0ut„” said this FBI agent. A good .example of the .above, has now occured in Davie County in connection with the .epidemic of break-ins dur­ ing the past year. Ever since .the.first break-iri last Jan­ uary 7, local Qffcers have been •atvwork on the case. They have had many leads—followed ;all—only to find many of them false. However., it was this patient tracing of all leads that finally paid off in breaking the case. A tip that a man had bought a gun—* check showed this ;to ]be true—The man told where he ibought it—further investigation, and the case began to uiaravel. Even after the case was solved there was much work to do. There was travelling of great distances following the path of one stolen gun which was constantly changing hands. This was done on many items in most all di­ rections leading out of Mocksville. But the result was the recovery of a great deal of stolen goods which will be used as evidence in the forthcoming trial. Being familar with the glamorous solving of crimes as depicted in the movies and on television, the average lay­ man often times becomes impatient with what appears in reality to be our slow moving process of law. However, if he will practice a little patience, strive for a little more understanding he will appreciate more fully the services that local officers are rendering. Humn 3s Bern, ~) B Y C L IN T 4 B O N N E R w * * > ^ 5 Away In A Ma n g e r A fighting man writes a tender carol ____THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 17, 1953 With ashes of religious martyrs strewn over Eu­ rope, a perpetual series of court battles and pros­ pects of beinfi burned at the stake, none but the most resolute character would have dared oppose authority of the ancient Roman Church. But Mar­tin Luther was a most resolute character. Luther has been labeled "the shameless monk” . . . “a child of the devil” and “a barbarous writer and demagogue.” The leader of Europe’s religious Reformation has also been called “an extraordinary genius" . . . "an inspired personality” and “the champion of conscience and individual freedom." The light in which Luther might be regarded de­pends, of course, on which side of the controversy Ucs the individual's sentiments. But none can deny that Martin Luther led a strenuous and eventful life, that he was resolute and determined in his convictions and that he wus dauntless in purpose. “I was born to fight with devils and factions," he once said, “. . . let me speak the truth with too great severity than once act tlie hypocrite.” Nor would a timid soul have stood in Away in a monger.No crib for a bed, The little Lord Jesus Laid down His sweet head; The stars In the sky Looked down where He lay, The little Lord Jesus, Asleep en the hay. The cattle ora lowing.The Baby awakes. But little Lord Jesus, No crying He make*; the court of Charles V and dared defy the emperor. But as a rule the strongest men are tlie most gentle. The same Luther who boldly nailed his 95 thesis on the chapel door and publicly burned the papel edict of excommunication, loved nothing more than peaceful hours at home with his family.On Christmas, 1530, the fighting Reformer gath­ ered his children about him and read stories of the Nativity from the Bible. Then he took his little son, Hans (John) on his knee and wrote a Christ­mas carol. It is one of the tenderest of all children’* songs and has been sung for more than four cen­ turies at cradles all over the world. Some hymn books do not give the name of the author at all and some scholars say the author is unknown. Other hymnologists claim Luther wrote at least the first two stanzas as well as the music.So, while adults argue their points ol theology, and history records the most heinous of crimes in the name of religion, little children pay homage at Christmas to one who gave His life in the hope that grown men might live as free of hatred as children for whom these lines were written: I love Thee Lord Jesus!Look down from the sky,And stay by my cradle. Till morning is nigh. Be near me, Lord Jesus, I ask Thee to stay Close by me forever, • And love me I pray; Bless all the dear children In Thy tender care,And take us to heaven, To live with Thee there. ■ xuirt ib bUKH" Copyright W W U W J W W W y W W A V .V W .W v W . W A W A W . School Segregation The Supreme Court came face to face, with a highly controversial civil rights issue last week when the school segregation cases were heard.' For several years the Su­ preme Court has attempted to evade a showdown on the question. It refused in 1952 to accept a school segregation case because a lower court had not yet reported to it on results of an order for a state to equalize its facilities for the Negro race. Ever since 1896, when he court had established the principle that separate but equal facilities were not neces­ sarily discriminatory, schools have been segregated in at least 17 states and Washington, D, C. Even in December of last year and the Spring of this year, the Supreme Court refused to answer the question put by plaintiffs in the five cases just heard. That ques­ tion is: Does segregation in itself, in the schools, constitute discrimination? After hearng the arguments on these cases, and this question, in December of last year, the court several months later, neatly handed the ball to attorneys for each side and the Justice Department. The high court asked the attorneys and the Justice Department if it had the auhtor- ity to end segregation in the schools and if it did have, how should it be done? Last week the two sides answered these questions for the court. The states of Virginia, South Carolina, Kansas and Delaware and the District of Columbia, argued that the court didn’t have the power and the plantifis argued that it did. The decision now rest with the nine Justices. Did You Know? Did you know, that according to 1952-53 statistics, Davie County with a tax rate of 65c ranked first in North Carolina'. That with a total assessed valuation of $34,- 104,00 it ranked 15bh in North Carolian in average per capita? Did you know that there were a total of 136 deaths and a total of 401 live births in Davie County during 1952? This gave the county a death rate of 8,8 per thousand and a birth rate of 25.8 per . thousand. The State average for deaths was 7,7 per thousand and for live births was 24.8 per thousand. Did you know t/hat as of September 1, 1953, there were W U W W V W . W W W A W Sir Winston Churchill, in what might have been the elder states­ man’s last international confer­ ence, came to Bermuda to meet with memories of many other con' ferences with American leaders during World War II. Cihurchill cooperated closely with Presidents Roosevelt and Truman and met with both on numerous occasions in the hectic d£(ys from 1940 (when he was made Prime Minister) until 1945 (when he was turned out) and again (with Presidents Truman and Eisenhower from 1951 through 1953. As First Lord of the Admiralty during the first part of World War I, he also served his country in many joint strategy meetings, of that day. As he headed for Bermuda, earlier this month the British warrior must have won­ dered if he would carry the day this time. More often that not, the American Chiefs of Staff and President Roosevelt had their way during World War II when dis­ putes arose. Churchill favored at Bermuda a little of what his immediate fore runing had one astray on back in 1933. Sir Neville Cham­ berlain had tried to talk peace with Hitler when the Nazi dicta­ tor wanted war. Of course, Churchill showed only a fraction of hope’ Chamberlain had clung to, just enough to think another effort to confer with the Russ­ ians might be worthwhile. President Eisenhower’s advisers had primed the Chief Executive well before he.left Washington— on how to resist the Churchill per­ suasive charm, Ike has had ex­ perience on that score already, for in World War II, ho resisted Sir Winston on several major proposals, vigorously pushed by the Prime Minister. Ike went to the talks convinced conferring with the Russians was wasted time. Churchill' did his best to convince him there was nothing but a little time to lose— in another meeting with the Reds. In the fend, this time, Ike was not immovable. If the Russians are really in favor of a Big Four conference, they can have it. Tlie results will show whether there was any reason for it, from the U. S. standpoint. •".'v W .’ .W .V A V A V - ' :.2 eight-jet heavy bomber. Deputy Secretary of Defense Rog- | Keyes admitted as much in a i .'rent speech, and Air. Force of- j ficials are optimistic over prob­ able performance figures for the e: giant. Top speed for the new heavy is said to be in interests of that attained by the heaviest U. S. Air Force jet bomber now in quan­ tity use, the B-47. The B-47 is a medium jet bomber, and has been clocked at over 655 miles on hour. The B-36 heavy, powered by conventional and jet auxiliary trust flies at speeds which are several hundred miles an hour slower than that of the B-47. It has been assumed by some that the heavy jet bomber would not be as fast as the B-47 medium, but its superior speed will put it near or beyond the 700 mile-an- hour class. Flying at such a speed, this heavy jot bomber (first deliveries of which begin late next year) could take off from New York and be over London in something over three hours: It could bomb Moscow, from bases in England, in less time than that! The new jet heavy will be so fast few fighters will be able to worry it much, until rocket interceptors are available for defensive use against it. It can fly so high anti-aircraft and gu::!od mbsles fire will be highly inaccurate. ' 60 Second Sermons B y FRED DODGE BIG SEASON This is the meo and Juliet (“and he up andl big seascn of the year for Caro­ lina Motor Club, with headquar­ ters in Charlotte, which handles the sale of untold thousands of license plates for the State of North Carolina, receiving a tidy rum therefor. The so-called club, which is re­ garded primarily as in insurance agency, receives from the State 17 cents for each' license plate sold through them.. The firm or organization which in many cases completes the tran-action has been getting nine cents.- done a s'.iloquy right thur” ). Meantime, Capital through its. nationwide connections has helped line up some attractive big-time night club engagements for Grif­ fith and wife . . . and all because of a little old phonograph record (and years of dramatic training and experience). PRESDENT . . . Some time be­ fore long—probably early in the new year — Ernest Woods is scheduled to become chairman of Sometimes the board of Independence Life this sales outlet is a chamber of t Insurance Co. Waldo Cheek at commerce, a private firm,, or a -40 will become one of the young- merchants association. I am told that in one Eastern North Carolina community the organization selling the license olates can’t operate on the- nine- cent margin. The city helps out by giving it a cut of 50 cents—or 50 per cent—on city tags. Yes, from now until February 1. the dollars will roll into Car­ olina Motor Club coffers. NON-PROFST . . . There ai*e 10,000 insurance agents in North Carolina. Why should one firm have this terrific strategic advan­ tage in contacting the motoring public, The Carolina Motor Club is one of those “non-profit” things. Well, it's just another insurance agency; and it is our honest opin­ ion that 90 per cent of the insur­ ance agencies would be content to become non-profit tomorrow if their operators could receive the lucrative salaries paid oper­ ators of Carolina Motor Club. > Coleman Roberts, manager is ’ the only private citizen we know of receiving one of the State’s honored1 and much - sought-after low license numbers. Text: “If thou canst’ believe. All things are possible to him that believeth.”—Mark 9:23. John Wesley tells of a young convert who had been to North England to preach. After a year, he returned to Wesley, searching for the reason that his preaching did not make more converts. Wes­ ley asked him, “You don’t expect to have con­ verts at every meeting do you?” “Oh, no,” said the young preach­ er, “not at every meeting.” “Then,” said John Wer.ley, that’s the reason you are not having more of them.” Defense Department officials are pleased with progress now be­ ing made on production of the T h e automobile companies, contrary to some predictions, ex­ pect new car cales in the first half of next year to come very close to this year's sales in the same period. The mood is one of cau­ tious optimism, now, not pessi­ mism. The market is expected to be highly competitive but there will be plenty of buyers for the retail­ er who hustles and makes a good offer. That’s what it looks like is the trade, on the eve of 1954. CHRISTMAS PARTY Circles 3 and 4 of the Woman’s Society of Christian Service will have a joint meeting on Friday night, Dec. 18, in the Fellowship Building of the First Methodist Church. Miss Janie Martin and Mrs. Otis Hendrix will present the program. “The Christmas Story” will be read after which carols will be sung by the group and gifts will be exchanged. 867 members of the Hospital Savings Association and 3,573 members of the Hospital Care Association living in Davie County? This gave Davie County the rank of 8th in the State for Blue Cross membership according to population which was 28.79. Did you know that with four dentisis in the county, there is one dentist for 3,925 people," That Davie County ranks 31st in this respect in the State. Orange County ranks first having 21 dentists for a population of 1,748 per dentist. The majority of our important inventions came about' because someone believed. That belief carried them through the many discouragements' that had to be passed before they attained suc­ cess. Men, struggling toward wor.’cl peace, must believe deep in their hearts, that they can reach it. In medicine science, bus­ iness, religion—in day to day liv­ ing—we must believe 'if we are to achieve. Jesus put no limits on believing. The world’s greatest Teacher said, “If ye have faith as a grain of mustard seed . . nothing shall be impossible unto you.” Believing is the greatest magic in the worldr-Are you us­ ing it? THIS IS CHRISTMAS Christmas is a tree with bright lights and tinsel and the Star atop. It is a tumble of gifls, wrapp­ ed with pretty ribbons, beneath its green boughs. It is the light and faith in little children’s eyes on Chris'.mas morning. It is the chok' ing feeling of joy in mother’s heart as the packages are open­ ed. It is the tear that swells in dad’s eye and he tries to hide it with a grin. It is the femembrance es of many other Christmases by grandmother and grandfather un­ dimmed by golden time. It is the sermon of the Story of Bethlehem, The hymns of the choir, the candlelight, the soft­ ness of children’s voices, the peace and good will that can come into mcn’i hearts. It is the joyful music of chimes and church bells, the carols from the record shop, the spirit of the season that makes strangers friends. :st'life insurance company pres­ idents in the U. S . BIDS . . . Now, as pointed out, the State is paying Carolina Mo­ tor Club 17 cents for each li­ cense plate sold through them. It may be that the State could get a better deal with some other agency. Perhaps clerks of court and chambers of commerce could handle the sale of license plates. They might do it more cheaply,' thus saving the State money. In any event, this would be . more fair to the other 50,000 insurance agents, many of whom must daily compete with Carolina Motor Club. The whole thing should be studied. ' No firm, profit or non-profit, selling insurance to the motoring public should be granted the privilege of selling State license plates, even if there were no profit in it, to the motoring pub­ lic. This is manifestly unfair com-- petition. If the State insists on calling in an.outside firm or agency t6 help in selling the license plates, then it should open up the whole shebang for competitive bids. That’s the way North Carolina buys its other services and pro­ ducts. Why not make it applic­ able to the sale of license plates? THE SCHOLAR . . . A dillar, a dollar, a ten o’clock scholar. Some of these' judicial scholars’ are that'— and maybe more. Two or three weeks ago we were out on a trip with- three fellows, frons various sections of the State. We' were talking about everything. It developed that one of them had' recently been called for jury duty- Another safd he too, had recently- served. About that time the third sang out that he was also' Galled! early in the fall. They compared notes, these three men from three different areas of the State, and found they had been urgently requested to be in the court room and ready for business at a given hour at their peril. Fearing being charged for contempt of court or other more serious crime, they were in court, alert and ready, at the appointed time. Each recalled how he sat around boredly looking at the clock, watching the clerk as he whispered to the witnesses, the law enforcement officers and others. Time dragged' along. Finally, after about 45 minutes of waiting, they felt like jump­ ing out of there and going- back to their jobs. But at last in strolled the judge as nonchalantly as a man hoeing cotton. -This was the situation three jurors found ex­ isting in their respective coun­ ties. How is it in yours. How can the honorable judges expect sharp cooperation on the part of citizens called for jury duty if they don’t treat them — and their time — with more consideration? And: would our various courts be so far behind in their cases— and: would it be necessary to add more and more judges if there were more efficiency on the part of the judges and others in the operation of our courts. PEARSON SUIT . . . As we go tn press, investigation of the Charlotte Police Department goes merrily chugging along. That old merry-go-rounder himself, Drew Pearson, la^t week came down for some—closeddoor statements before the grand jury investigat­ ing the situation. If we mistake not, Brother Pearson instigated the examina­ tion. I hear that Charlotte Police Chief Frank Littlejohn is burn­ ed to a cri-.p and has told friends he will sue Pearson for $150,000 if charges made by the Washing­ ton writer do not stand up.' Littlejohn has said the money he recovers—if any—will be turn­ ed over to Charlotte charity or­ ganizations. $5,000 PLUS . . . My friend and old Navy sidekick, Orville Campbell has sold the copywright to Deacon Griffith’s football rec­ ord to Capital Records, Capital’s sales manager flew down from New York to Chapel Hill last week, presented Camp­ bell with a check for $5000 repre­ senting advance royalties on the sale of the record, and the sum could go on up to $50,000 if the thing catches on nationally as it has in North Carolina. Campbell and Griffith will receive about eight per cent of the gross from “What it Was, Was Football" and the Griffith interpretation of Ro- Florida Gov. Charles Johns told me if he could have his way, he would spend his winters in Miami and his summers in the mountains of North Carolina. When I was a youngster, my biggest hope at this time of the year was that I could get a pony for Christmas. It was all in vain. But now I have come into posses­ sion—I don’t actually own it but have full use of it—a golden Pal­ omino stallion, registered and a double for Roy Rogers horse, even to the name of Trigger. A trained parade and trick hor^e, he can do a lot of things, most important cf which is to kneel for me to mount. Tha’ts important at my :if'e. A friend of mine let me have the horse because I happen to have a barn—in fact live in one—and they don’t. We will officially observe Christmas .with the William F. Bailey’s, read Dickens’ Christmas Carol, and enjoy Christmas thoughts and munic. Bailey is State Director of Prisons. The Bailey’s have two sons: one in grammar school; the other a crack footballer at Staunton Military Academy. Whj lly Ilil.L (\ulso.> "It »eera» good to have a quiet government. . . for too long we’re been all atreaaed up with mo placa tog* I” < THURSDAY, DECEMBER 17, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE PAGE THREE Cana, Fork and Farmington Postoffices May Be Closed Farmington P.-T. A.Group May Protest - "Davie County faces the loss of three post-offices in a pending economy move of the postal de­ partment. Post oti'ices which it is under- r.tood that the United States Pos­ tal Department is considering abolishing are the ones of Farm­ ington, Cana and Fork. AU are £ourth-lass post ofiices. It is understood that the postal the best gift of all....: n s a fig noupnv trip Hupp Feed MillMocksville, N. C. Mention "Travel Kit” to a man who knows quality—who wants a kit that’s leak-proof— and who is particular about smart appearance—and he thinks of DOPP-KIT! For only DOPP-KIT has the iamous leak-proof lining. Space-saving, too — closes snug and flat, exoands to accomodate all his personal toiletries. In finest leathers. $5.00 to $10.00 THE MARK OF THE WORLD'S MOST FAMOUS HATm make Stetson paif of vm man g ive h im a R P i § ^ v r Sift Certificate Goodby shopping worries! The miniature hat box with tiny Santa hat and certificate tells him he can conic in and select hiV-own Stetson in the right style, color and size. FROM $10 * SALISBURY'S STORS FCP; i-'it-.U'’ S, r \ ■ SALISUUUY, N. c. Mrs. Robert DavisReceives Liccnse As Practical Nurse .Dress rehearsal for the Christ­ mas pageant will be held on Fri­ day night at 7:30. The Youth Fellowship Christ- -iar» party will be held on Mon­ day night, December 21, at the home of Kay and Vada Hilton, Mi's. Lillie Robertson, Mrs. Mary Hendrix, and Miss Lillie McDaniel, received boxes from the Women ofthe Church. Mr. and Mrs. Tommy Cornatzer and family visited Mr. and Mrs. George Cornatzer Sunday. Sammie Ha'word had the mis­ fortune of turning boiling water over his leg and foot Sunday morning. Mr. and Mrs. R. A. Hilton vis­ ited Mr. and Mrs. E. F. Collins Sunday night. « -'h'} v •/ , ' ' Mrs. Ruth Davis, above,, has reaenf.1V’ received her N. C. li- eenstas- a practical nurse. Mtsi. Davis: is presently em­ ployed a'.; supervisor of nurses at the Lynn Haven Nursing Home in Mocksville. She has been as­ sociated with this type of work for-the> past seven years. She took her examination for license as a practical! iwirse this past' Septem­ bers She. was the former Ruth Whit­ lock- and a native of Davie Coun­ ty; She is married to Robert Da- viS; of' Mocksville. Dr. P. H. Mason is now back in his office after being in the Bap­ tist hospital in Winston-Salem for an examination and checkup, Mr. and Mrs. Raymond Siler of Thomasville attended the Christ­ mas party of the Thursday Night Bridge club held last week at the home of Mr. and Mrs. Robert Hall on Halander Drive. Mr .and Mrs. Richard Columbus Barnes of Route 3, announce the engagement of their daughter, Lelia Virginia, 204 Maupin Ave., Salisbury, to Richard Wade Thorpe of Greensboro. Mrs Barnes is presently employer as Secretary to the Registrar, VA Hospital, Salisbury. Mr. Thorpe is connected with Western Electric Company of Greensboro. A winter wedding is -planned. department is' c ou"idering serv­ ing all these areas with routes out of the Mocksville office. This would include operating the pres­ ent Cana route also out of the Mocksville post office. Postal inspector:; were in Da­ vie County last week surveying the possibility o f these moves. The Farmington Parent-Teach- ers Association went on record Friday night as being opposed to the closing of the Farmington post office. 'They voted to advise the postal authorities in Char­ lotte. Members were urged ' to write individual letters to F. R. Hayes, Postal Inspector, Char­ lotte, stating their views on the subject. ; ' ■ * The economy move is in line with that started in.Wilkes Coun­ ty early this year when,13 fourth- class offices ".were closed ill a wholesale revamping .of service. Pont Office Department officials in Washington, pirtially reject­ ing a stormy Wilkes protest, said at {he time the reorganization PENNINGTON CHEVROLET C0„ Inc. Phone 15G-J Mocksville, N, C,j fef* there might well rrt a national pattern fo refficiency and econ­ omy. j Surveys have already. ,been| started in several other North Carolina counties in line with’ that policy according to postal authorities. The Davie rtudy is among the group, though no for-, mal recommendation of changes has gone to Washington yet. | --------:---------------i James Durham of Cana has been accepted for a four year en-: listmenl in the Marine Corps and has been sent to Parris Is­ land, S. C., for training. | William A. Stroud has been accepted in the U. S. Army and is now training at Camp Gordon, ! Ga. Mrs. Stroud is now living with her parents, Mr. and Mrs.1 W. P .Hendricks, on Wilkesboro' Street. .......... . ' i REDUCED PRICES On Christmas Toys and Gifts Super Wagons $4.95 up Tricycles 86.95 up Tractors..... ..................... $17,95 Up FIRE TRUCKS — GUN AND HOLSTER SETS — CARS — MIXERS — TOASTERS — TABLEWARE — CHRISTMAS LIGHTS AND DECORATIONS COME IN NOW • * • __ _ _ _ . ■ * ' • •Miller - Evans Hardware Co. —At Intersection of Yadkinville and Statesville Highways— Phone 65 Wiikesboro St. Mocksville, N. C. & Jk m S A L E Saturday, December 19, is our big Reopening day. Come in now and reigster for free baskets of gro­ ceries to be given away Satuday. HERE IS A PARTIAL LIST OF SPECIALS ON SALE FOR THE BIG EVENT- 8 Packages GUM........................25c ROUND STEAK..............49c lb. 4 Rolls CHARMIN TISSUE.........33c ORANGES ................2 dozen, 45cCIGARETTES......... per carton, $1.69 HAMBURGER................35c lb.10 lbs. SUGAR .....................99c 1 lb. ZESTA CRACKERS..........25cEGGS .................... 60c dozen 1 lb. PREMIUM CRACKERS.......25c FRYERS ....................39c lb. PECANS.....................29c lb. MANY OTHER GOOD VALUES ON OUR SHELVES9 FREE BASKETS OF GROCERIES WILL BE GIVEN AWAY AT 4—5—C P.M., < O SATURDAY. COME IN AND REGISTER NOW! I K i g e r S elf S e r v i c e G r o c e r y North Main Street Phone 103 PAGE FOUR THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 17, 1953 Pits© Grange In Meeting The Pino Community Grange hold it’s regular meeting on Dcc. 7 at the Grange Hall with the master, J. E. Essie, presiding During the businosT session, the Grange hetfrd the following re­ ports from, committees: • 1.. The Telephone committee reported that progress is still be­ ing made on constructing tele­ phone lines and that the work is proceeding on schedule. | 2. The committee on securing a doctor for the Farmington com­ munity reported no new progress since the last, meeting. They re­ ported sending out several letters with replies being awaited. | 3. The fire truck committee re­ ported that a deposit of $1,000 haft been paid on the truck of which acknowledgement had been madn by the General Motors Cor­ poration. The truck (chaste) only i~. expected to be delivered with-! In 30 days. Tbe committee report­ ed that around $1800 has been collect.^ by the Farmington Vol­ unteer Fire Department and they urcT'x? those who have not cov- o-ed t>eir territory to do so at the earliest possible date. £ 4. The "Honor Community” committee reported that the scrap­ book had been completed by Mrs. C. K Leagans, and that the judg­ es had toured' the community. Pino community was awarded a ’ “red ribbon’ for it’s work in the contest sponsored by the Winston-, Salem Chamber of Commerce. | 5. The quilt committee report­ ed that the 1953 quilt will be awarded to the holder of the lucky ticket at the installation of officers meeting sometime in Jan­ uary. Only members of the Grange are eligible to participate in the drawing. I 6. Mr. and Mrs. Hubert Boger j were presented with the . third place award in the Pino Grange local community service contest. Mr. and Mr.-.. Boger were not pres­ ent when the other prizes were awarded. 7. The Grange voted to hold the special meeting for installa­ tion of officers during the first week in January. The literary program consisted of family stunt night with. each family participating. Refresh- Sgt. Walter Miller Receives Promotion •I % \-v .. ■Vv. '.fc-» }■r Sgt. Walter J. Miilcr, Jr., of Camp Lejeune, husband of Mrs. Mable. M. Miller, also of Camp Lejeune and son of Mr. and Mrs. Walter J. Miller of Cooleemee, wa~ recently presented with a meritorious promotion to the rank of sergeant for outstanding work in the administration branch of the U. S. Marine Corps. Shady Grove ^.-T.'A. Meets ■The PTA of Shady Grove school meit on Monday night in the school auditorium. The Christ­ mas P’ ay, “Gracious Gifts Are Given” was presented at this meeting. . After the play the audience j participated in the singing of Christmas carols. ( Immediately follownig the carol singing the group adjourned to the cafeteria where doughnuts and coffee wore served. The cafeteria was atractively decorated with the Christmas motif for this occasion. IT’S A DATE A package of extra large moist dates, extra large figs, and a tin of mixed salted nuts—especially nice for television parties. Sgt. Charlie H. Lakey Now At JFort Bragg Sgt. CharlieV.H. Lakey, son of II. A. Lakey, iRoute 1, .Mocks- , vlHe, is a member of the GGtli ! Signal Battalion, ; ; . .' I Sgt. Lakey is; now participating j in an advancoa/jindiyidual train- I irg course being!'conducted by the ! GGth Signal Battalion Corps at Fort'Bragg. | The Battalion -was organized in j June, 1952, at / Fort Bragg and has been engaged in training for its mis .ion since that date. The primary mission o f .the 88th Sig­ nal Battalion is ; to “ provide ade­ quate communicati6n:!!to, units operating under. jthe.-XVin Air­ borne Corps Headquarters, The Signal Battalion also pro­ vides for photographic assign­ ments and maintains signal equip­ ment of the XVIII Airborne Corps. CHRISTMAS EVE MEMORY CHECK Did you Remember . . . . . to take home a few extra toys? If you are expecting two or three neighborhood small fry I o drop in, you can be sure six■;J i */T j . ■will show up. And:.three,toys and six children,, dox,no^ enhance “Peace On Earth/’’ -jit: i Did •i i,i Remember,, ments were served by Mr. and Mrs. Ira Seats.' The next meeting will be on December 21 and will be cen­ tered around the Christmas thenie. Each member and ghild will bring a gift of nominal value. you nemi'inoer, ,,, , .; . . . to check-the, Christmas tree lights? Not day; before yesterday. Not last week We mean right now. A few stores are still open and you can supply new. ones. ^Better pick up a few more ornaments, too. WORE ABO U T— i,'iv i: *iChristmas Programs - Wesley'^ Chapel . The Christmas'exercises of Wes­ ley Chapel church will be pre­ sented Friday.ijevfning, Dec. 25,. at 7:30. nr-r. ■ Bethlehem - Methodist Bethlehem Methodist Sunday school will give their Christmas pageant Tuesday! night,: Dec. 22, | at 7:30 o'clock. Cornatzer Methodist The Cornatzer Methodist church; , will have ■ their—Ghr jstmas pro­ gram on December 23, at 7:30. BILLFOLDS Ladies’ and Men’s3.50 °p 19 |*w*l Lady Elgin with gractfully faih- lontd and plteai and - cau al rich 14K gold. STRATFORDS JEWELERSNorth Main Street Mocksville, N. C. ...... ' Sanford’s Suit sale continues through Dec. 31 ^ House Shoes Galore Many of our customers have already taken advantage of the big reductions we have on MEN’S SUITS. One group nationally advertised JZ, off Suits, values to $54.50 .................................. ALL OTHER SUITS NOT INCLUDED IN THIS GROUP...:................................10 % off Place bedroom; shoes at the top of your Shopping list—your best friend will appre- cite a pair of these from SANFORD’S _ Pn.. LOUNGING PAJAMAS — QuiltedLOUNGING ROBES Ijrlllfe 1UI nei Quilted Silk and Cotton — NYLON'GOWNS — SLIPS AND PAJAMAS—SWEATERS, nylon and 100% wool HOSE — GLOVES — COSTUME JEWELRY — STOLES Ladies HAND BAGS. — SAMSONITE LUGGAGE — COATS — SUITS AND DRESSES—-George Washington-Golden Jubilee BED SPREADS. ‘Big promotion on Men’s Nationally Advertised all leather , l\F^«Ar 4£l A A BELTS, $1.50 values ................ ........... Gobs, Gobs and Gobs MEN’S TIES, standard brands in really beautiful patterns. Useful Gifts for the entire familyAlso solids. 4fcl A A . 4^1 HPRICED AT .......,,............. || ELECTRIC PERCOLATORS — DORMEYER ..DEEP.. FRYER..ELECTRICJUST RECEIVED new shipment of MEN’S SOCKS—rayon, nylon and beautiful U TOASTER — ELECTRIC WAFFLE IRON WITH GRILL — ELECTRIC IRONS plaids. Packed in Christmas boxes. Check 50-$1.94-$2,911 —ELECTRIC HEATER — BRASS AND IRON SETS — FIRE SCREENS —our assortment before you buy. Per box ^ A „„ . A „ „ „ , ,.f , f M An M RADIOS — ELECTRIC BLANKETS —All Wool Chathom BLANKETS—GrandTMT ^ all sizes A-B-C-D, beautiful fancy stripes QQ im EMens rajailias and solkIs with trimmi„g to match. ll[ || Assortment ELECTRIC LAMPS — 16 Piece PYREX DINNER SETS. C. C. SANFORD SONS COMPANY SINCE 18G7 WE GIVE S & H GREEN STAMPS MOCKSVILLE, N. C. THURSDAY, DECEMBER 17, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE PAGE FIVE N W .V .'.W .V V .V .V .V .W .V .V .W .V .V .V .W .'.V .V .'.W .W w . iv A V V .V .V .V .V .V .'.V .V .V .V .V .V .V .V .V .V .V .V .V .V .V V A Ml-, and Mrs. Walter E. Martin j Mrs. Ollie Stockton, and son of Bennottsvillo, S. C.,| Mr. and Mrs. T. S. Martin of were Week end guests of the W. F. | Martinsville, Va., have recently "Martin family. Miss Marie Johnson will arrive ‘from Morehead, Ky., the later part >of this week to spend theholi- ■days with her parents, Mr. and Mrs. P. J. Johnson. Mrs. H. O. Smith and Mrs. D. "W. Layman will arrive Wednes­ day from Charlottesville, Va., to spend the Christmas holidays with Mr. and Mrs. Knox Johnstone. The officers of the Presbyter­ ian Church attended a discussion on the union of the Northern and Southern churches held at the First Presbyterian Church in Salisbury Sunday evening. Reid Irwin of "Richmond, Va., spent the week end here, the guest of Miss Carroll Johnstone. Bob Waters of LaCross, Va., spent Sunday with his parents, moved into Mrs. Stockton’s apart­ ment on North Main Street. Miss Colcan Smith will leave Friday for Rocky Mount, where she will be a bridesmaid in tho Privette-Batchelor wedding Sat­ urday night. Miss Jane Click, a commercial student at Peace College in Ral- eighy.has made the honor roll for the first semester, and was rated thirdi'highest in the c'ass with a 95.8 gating, it was learned. Mrsl L. M. Graves and Mrs. Russell Bessent heard the: Mes­ siah^' Sunday afternoon at St. John’s Lutheran Church, in Salis­ bury. The Cub Scouts, accompanied by Bill Ferebee, J. E. Kelly, Dr. and Mrs. R. F. Kemp, J. K. Sheek, Jr., Mr. and Mrs. Robert Hen- Mr. and Mrs. Marvin Waters, dricks, James York, Mr. and Mrs. Mrs. J. D. Potts and daughter, Greg, of High Point were their guest on Monday. W. Q. Grigg, Jr., who holds a position as Public Relations Di­ rector at Coker College,. Harts- ville,' S. C., will arrive Friday to- spend the holidays with his parents, Rev. and Mrs. W. Q. W. W. Williams, and Cecil Little went'to Gaddy’s Lake near Wades- boro, - on Sunday. Miss Lynn Brbwn will arrive on Friday from Mitchell College to spend the holidays ■ with her parents, Mr.. and Mrs. H. W. Brown. Miss Glenda Madison will leave turn to college next fall for grad uate work. Rev. and Mrs. E. M^ Avett at­ tended' a Christmas tea in High Point::.the past week end. Lt. ’and Mrs. E. C. LeGrand, Jr., and son, Eddie, of Albany, Ga., arrived Saturday to visit his mother, ,Mrs. Margaret A. Le­ Grand, until Dec. 27. Mrs. George Byrd had the mis­ fortune to fall last week and break a small bone in her foot. She fell while visiting her mother, Grigg. Mr. Grigg expects to re- by plane Wednesday evening for Nashville, Tenn.-; 'to attend the graduation exercise at Gupton- Jo'ries College ■■'of Mortuary Science. Fredvliong, Ji*., of this city is a memberVpf the graduat­ ing class. Mrs. Bill Ellis, Miss Sharon and Susie Ellis attended the Hanes Knitting ' Co. Christmas party in Winston-Salem Friday night. Neil Bolton Is Rotary Speaker Rotarians heard Neil Bolton, head of the agriculture division of the Winston-Salem Chamber of Commerce, describe the im­ portance of making our commun­ ities a better place in which to live. , Mr. Bolton described,the.“Chal­ lenge Programr,” of the Winston- Salem Chamber of Commerce , of which the Clarksville Community was recently declared the winn­ er in Davie County. Leo Williams introduced Mr. Bolton. President Graham Madi­ son presided. Special guests included Rev. E. M. Avett of Mocksville and Rep. C. B. Deane. Miss Evona York served as pianist. . Princess Theatre Thursday & Fri.: “REACH­ ING FROM HEAVEN” with An All Star Cast, Cartoon and News. Saturday: “SOUTH PACIFIC TRAIL,” with Rex Allen. Al- son Cartoon & Serial. Mon. & Tues.; “EAST OF SU­MATRA” In Technicolor with Jeff Chandler & Marilyn Max­well. Also Cartoon & News. Wed. “MASTER OF BALLAN- TRAE” In Technicolor. With Erroil Flynn. Also Cartoon and Comedy. Phone 182 for Show Time huge: WALL ot tin cans at American Can5Company plant, made by the five men op-erating one production line for six minutes - today, contra ;one walker ■ in “old days. today, contrasts with six cans (foreground) lone walker could turn out in that lime SO GAG. iliat’s four-foot mastodon bone fouri near Ralph j Stutsman home at Goshen, Ind. The Stutsman's n'.ne new ter-j rier puppies figure they're not quite ready to gnaw it, yet. Christmas Program At P.-T. A. Meeting The Mocksville High School Glee Club1? presented an out­ standing Christmas program on Monday evening at the regular PTA meeting. They were assisted by Elementary school students. The program featured the sing­ ing of familiar Christmas, carols and solos by Shirley Wyatt, Jack Naylor, Reba Furches, 'Harry Os­ borne and Evona York. Impressive tableau scenes were also a feature of the program. Mis'? Joan Murray is the direc­ tor of the Glee Club. A short business meeting of the PTA was presided over by the president, Mrs. Paul Blackwelder, and at the conclusion of the meet­ ing the grade mothers adjourned to the cafeteria lo fix the Christ­ mas treats for the. school children. Birthday Dirtner The children of Mrs. E. J. Shel­ ton honored her on her 83rd -ljirthday annivesary last week at her home in Davie County, near Farmington. About 80 attended the party including children, grand children, and great grand­ children. Special guests were Mr. and Mrs. Tom Walker from Louis- ana; Sgt. and Mrs. Robert Richie and family of Ft. Benning, Ga.; Misses'Thelma, George'and Phosa McClannan, Winston-Sa'em; Miss Madelon Boger, Grady Beck', of Mocksville; Mrs. Will Kilby, of North Wilkesboro; Mr. Smith, Rev. and Mrs. G. C. Graham, Farmington; Rev. and Mrs. Joe Pinnix, Winston - Salem; and Mesdames Nora Dixon and Emma Lash, Cana. Birthday Dinner. . Mrs. B. J. Douthit honored,her husband and his mather, Mrs. Henry Douthis at a surprise birth­ day party at her home in Win­ ston - Salem on Saturday, Dec. 12. ' ! . Covers were laid for Mr and Mrs. R. J. Douthit, Mr. and Mrs. Henry Douthit, Mr. and Mrs. Howard Sherrill, Linda, Earl and Janice Douthit and Judy Sherr­ ill. During the evening Mrs. Dou- thit’s son, S. Sgt. J. W. Douthis called long distance from Ala­ bama to , say ““Happy ; Birthday After enjoying a large cake the group watched TV programs: Cub Scouts Meet The three dens of local Cub Scouts enjoyed a Christmas party pack meeting on Tuesday even­ ing at the Legion Hut with around 50 Scouts and parents attending the occasion. A movie entitle'd “Christmas Variety” was shown to the group after which the scouts ex­ changed gifts. Treats were pre­ sented to each scout and each Tout then presented their par­ ents with gifts they had1 made themselves. Mrs. Edgar Dickinson is the den mother for Den 1, Mesdames Robert Hendricks and Charles Crenshaw, for Den 2, and Mrs. W. C. Anderson, for Den. '3. Schedule of H. D.Club Meetings Bixby Club will meet with Mrs. Flossie Jones on Monday after­ noon, at 2:30. Gifts, will be ex­ changed and sick families in the community will be remembered with gifts from the club. Union Chapel Club will meet with Mrs. Paul Grey Hendrix on Monday, Dec. 21 at 7:30. Home­ made gifts will be exchanged. ■Funerals Jesse Dalton Nail 71 Funeral services for Jesse Dal­ ton Nail, 71, of Mocksville, Route 3, were held Wednesday at the Cornatzer Methodist Church. Rev. W. C. Anderson officiated. Burial was in the Advance Methodist Church. A prayer was said at the home of Mr. and Mrs. Albert Bowens, where he lived, prior to the fun­ eral. Mr. Nail was found dead in bed Tuesday morning. When he went to bed Monday night, he appar­ ently was in good health, Born Sept, 5, 1882, in Davie County, he was the son of Thomas and Pemmie Cornatzer Nail. He lived all of his life in Davie County. He was a retired farmer. Mr. Nail was never married. Surviving are three brothers, John and Ii. L. Nail, both of Win­ ston-Salem, and Alex Nail of Da­ vie County; and one sister, Miss Lula Nail of Winston-Salem. Mrs. James Franklin Baker James Franklin Baker, former­ ly of Mocksville, recently marr­ ied Miss Georgia Reed of Balti­ more, Md., the former ‘“Miss Maryland of 1951.” Mr. Baker is the sen of Mrs. Tressa Baker Messick, and the late William Franklin Haker, both of Mocksville. The ceremony, was held in the Cathredral of Baltimore, and at­ tended by 2,000 friends, relatives and dignitaries. Miss Reed was escorted by her father, the Honorable John H. Reed. The bride was most beauti­ ful in a French creation of Chan­ tilly lace and nylon tulle. Her cascade consisted of white or­ chids. The bridal party included eight bridesmaids, ushers, matron of honor, ring bearer and flower girls. The couple will reside in New York where Miss Reed is now ap­ pearing in the Regers and Ham- morctein production of “Me and Juliet.” IT PAYS TO ADVERTISE Production of Grade A milk in North Carolina during 1953 is up 14.6 er cent over that of 1952. High production l'rom a few cows is more profitable than med­ ium production from many cows. Misses Yvonne and, Constance Atwood, daughters''bf Mr. and Mrs. Gilbert Atwood/ of-'Mocks- ville, attended the bride.’ Mrs. Tressa Baker ’ Messick, mother of the grdom',!%,’6re a pale blue formal','^.accentuated by a corsage of, .white orchids.. Mrs. Re.edf : wore a. blue silk taffeta. ^ Miss ReedJ a lyric coloratura soprano, atVendeii':'the :Peabody Conservatory - of ’mUSic in Balti­ more. ......................... The grcom is a graduate of Mocksville.'/Wfih ^School;a ttend- ed the University, t of ^Alabama, and served .thV.ee’ '’years' .'in the Air Force.' . He recent-y .rcOittjileteSd • a very successful television contract and is now associated>Twith!-a' firm in New York. *iSi»Sl»3!SiaSiS:3lB« fi « 1 1K«HKKrt «RR« 'Irt«HK*SA|f R i § Helping customers select gifts of dis­ tinctive value has been a traditional service of our store. Whether a simple remembrance or an elaborate present, you will find here an appropriate gift-* at a right price ... ...and for the very best china—a wide se- lection of beautiful patterns by Haviland, tho most cherished name since 1842. ft We Invite you to come in and see our wide selection of useful gifts carefully chosen—while our stocks are fresh. v France "x vO°V A tke rus t o I UlheoborflSabilani J MAOe IN AMERICA *7 A e Q i j f t S i t Q f o MRS. CHRISTINE W. DANIEL Phone 241 Mocksville, N. C. GIFTS PURCHASED HERE WILL BE ATTRACTIVELY GIFT WRAPPED WITHOUT CHARGE wtem«peie!c>CKie>c<c>ctc<ec>c«!etcic«ieieie!e« Imported Salad Bowl Set Small Bowls ...$1 each •eioewMWc<ci«c<cc«(C)c«icieie(c«tcictctctcte« CLOSE OUT ALL LAMPS ROBES $9.95 to $14.95 P A JAMAS $2.95 to $14,95 HOSE $1.00 - $1.35 $1.50 - $1.65 GOWNS $3.95 to $29.95 PAGE SIX THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 17, i9S3 Bailey Admits Breaking Into. 19 Places In Davie entered, with cigars and cigar­ ettes being taken. On or about March 25, four places were entered in Mocksville. Marlin Brothers was broken into. An attempt was made to open the snfe by drilling and sawing off the hinges. This attempt fail­ ed largely bccau-e the man was trying to use a wood drill on a steel r.afc. A rifle was also taken, but it was left on the back porch of the store. , Using a crowbar stolen from Martin Brothers, the robber then went to a Negro pool room and a Negro cafe across the street, jimmying the doors at the two places and taking a small amount of change. From there he went to Alli­ son - Johnson Grocery Store where he was discovered by Po­ liceman C. R. Plowman who was making his rounl about 4:30 a. rcu Plowman and the man saw each other about the rame time. 'The man ran towards the rear ofthe store, with Plowman runn­ ing around the side. Alone at the time, Plowman fired a shot in the air to attract help. With the firing of the shot, the man ran back towards the ONIY VanHeusen I 8« % i I & .8 IX jl ft | has the soft collar that won’t wrinkle ..,..ever! r a ywys?Vs?• M »■ § » s? y • if-. » 5?s? &. •it ■V■Si: v ■■ » y w w • v f/-’ W W -w-.-.a Here’s the secret of the sensa­ tional "Van Jleusen Century shirt: • collar is woven in one piece » no sewn or fused layers lo wrinkle • comfortably soft • no starch' or stays. Exclusive woven-in. fold line , always looks right! Van llensen ■ "Comfort Contour” .styling makes liegnlar or Widespread cnllar set low, look snmrl. Kxpert Van Hciisen tailoring tlmniglionl! A new sliirl free if vmir Van llensen Century . shrinks out of siv.c. $3.95 GIFT SUGGESTIONS Revere Sweaters $3.95 to $12.95 K'e’e'e'e^isis^ie^te'eteistg’steie^Botany Pants $14.95 to $18.95 ^ete»-st€ie'eiC!€t€te!C(«!gtgEfi:’«t€ietefe■Hubbard Pants $8.95 to $14.95 R9l9sSlS)ai»3s»& S ;»l»Si3lSl3!5l »3lMallory Hats $7.50 to $15.00 &3l3sfcS]Si5l&3]SjS]Sj2]2l5i3l3}3]3l3i•—Swank Jewelry ■Holeproof Socks Botany Ties —Jarman Shoes —Pieneer Belts <?»2K IJ* 3* *53 S? "2a 3j 2 i &« Di S • 3* Si 3 —Rolf Billfolds —And many other fine gifts front door, broke the glass and escaped. This man ran across the lot in the rear of Rankin-Sanford Implement Company and procecd- el in the direction of Davie Mo­ tors, Inc. About this time a bus came by, the man flagged it and rode to Winston-Salem. O.n or about April 27, the Mocksville High School was en­ tered. Only a few items of value were reported mis-ing. On June 4, Miller - Evans Hard­ ware was broken into. Entrance was made through the breaking of a toilet window. Four guns were taken, but three,were hid in a combine on the lot of. the D and M Harvester Company. The guns were discovered there by Sheriff G. Alex Tucker and Deputy Ran- some Cook. A trip was set to catch the man if he returned, but considerable watching and wait­ ing proved to be in vain. On or about June 10, Penning-1 ton Chevrolet Company was again broken 'into and around $140 re­ moved from the safe. This time| an old mattock was used to chop through the walls of the fire­ proof safe into the money vault. Al~o robbed during this same per­ iod two stores at Fork were also robbed. On June 26, the service station of Louis J. Miller, located near tho Forsyth County line on high­ way 158, was broken into. A rifle and a bag of pennies were stolen. Al-o several more robber­ ies occured in stores In and around Fork and Advance. On or about October 22, en­ trance was made into the office of Davie Lumber Company. Three dollars was reported missing from a filing cabinet. Miiler - Evans was again entered and four guns reported missing. Included with tho four guns was one that the officers had previously discover­ ed in the combine. The local high school was also entered, but only ome change left in a cabinet was reported missing. All this time Sheriff G, Ale:: Tucker nnd deputies, Mocksville policemen, and the State Bureau of Investigation were working night and day in the attempt to put a stop to these break-ins. By thin time the officers wore of the opinion that the robberies were lceal, rather than by transient personnel. The pattern of all the break-ins seemed to be about the same. On Nov. 5, Sheriff G. Alex Tucker, the Town of Mocksville, and various busine-s concerns an­ nounced the offer of a $200 re­ ward for information leading to the arrest and conviction of any parties or party breaking and en­ tering certain business places. Sheriff Tucker promised to hold the informer’s name confidential. On Nev. 7, Livengood’s Store at Fork was broken into/Cigar­ ettes, chewing gums and around $25 In money was taken. This was on Saturday night. The following Monday night; Nov. 9, Martin Brothers was en­ tered and seven guns and a coast­ er wagon was taken. Officers' tracked the coaster wagon around the store into the vicinity of the railroad tracks. Here the trail was lost. However, the wagon loaded with guns was pulled down high­ way 64- in the direction of Fork, leaving the open highway when­ ever a car approached. One time, while off the road in a field, the wagon apparently overturned. Here the man last a stock from one of the guns which was found by tho officers at a later date Then came' the first break in the case. As a result of the re­ ward offer, Sheriff Tucker re­ ceived a confidential tip that led to the recovery of one of the stol­ en guns on Nov. 17. The recovery (Continued on Page 7) l i f e ’ s'isf:faon Phone241 Just sit b a ck a n d re la x — it's so q u ic k , easy a n d co n v e n ie n t . . . bo lo w in c o s t . . . fo r e x a m p le : Baltimore, Md.......................$ 8.20 Washington, D. C................. 8.10 Norfolk, Va.............................. 7.10 ’.f ' ' Winston-Salem,' N. "C. ........ .65 Columbia,' S. C..........~.......... 4.05 j New York, N. Y.....................% 12.00 | Plus U. S. T ax. Big Savings on Round- i ‘ Trips ’WILKINS DRUG CO. Phone 21 Mocksville, N. C. iw eew c«w s® sw w ^ ^ « « * ’€W«wcNci«ps*««®8«!C«*ie!si6«eBie«ies« • Open each evening s5 2 S| ‘TIL 9 g n g^ from now » A£ until Christmas «« E One Used 12” Crosley ......... $98.50 New 19” Zenith TV .........$198.50 New 17” RCA (was $289)........$149 New 17” Emerson ...........$198.50 New 17” Westinghouse TV (was $249) NOW..................$198.50 —GIFTS FOR GROWN-UPS-Hassocks.....$4.50 to $12.50 giff Coffee Tables .... $12.95 up gEnd Tables.........$1.95 up jSecretaries .... $98.50 to $119.50 | Kitchen Stools .... $3.50 to $14.95 Smokers.......$1.50 to $4.957-Way Floor Lamps 9.95 to 39.95 y •4 y w H m Table Lamps...$2.95 to $39.50% All Types Traffic Appliances —GIFTS FOR CHILDREN— Schwinn Bicycles (all sizes)$49.95 to $84.50Tricycles .....$7.95 to $22.50Sidewalk Bikes $22.50 to $34.95Wagons.......$2.95 to $12.50Childrens Desks $29.95 & $39.95Doll Carriages........$14.95Doll Beds ............ $4.95Toy Pianos ........... $9.95 ^ Davie Furniture Co. Is On The Square PI10112 72 Mocksville, N. C. o • s E m y Item Listed Hege Is A Big Value Typical of The Kind You Always Find At Lowe's! 4 P T . B A R B E D WIRE H O W A B O U T T H IS ? C a n y o u rem em b er a n y o n e a d vertisin g h ea v y ga lva n ized 4 -p o in t barbed w ire at su ch a lo w p r ice ? A n d all y o u w a n t! G e t y o u r su p p ly o f w ire righ t n o w ! R O L L O F 8 © R O D S O N L Y . . $C75 A lu m in u m is n o w lo w en ou g h to p u t it o n all o f y o u r bu ildin gs and en d ro o fin g w orries fro m n o w o n ! C orru ga ted o r crim p ed — B u y righ t n o w — LOWE’S I, LOW NICE 0F Per Sq.. (1 0 0 Sq. Ft.) G A LV A N IZED R O O FIN G $045 1 .4 m ■(f* ^ WJ It C rim p style ga lva n ized ro o fin g — pressu re en d top s seal the en d — leak p r o o f— flat to p crim p m a k es easier n ailin g — S u p er-coa ted fo r lon g er life. LO W E’S LO W P R IC E FIELD FENCING L O W C O S T F IE L D F E N C IN ^ . . . M a d e o f h ea v y 1 2 V* g a u ge $ 1 4 75 galva n ized w ire w ith 6 in ch stay. H ere is a fe n ce that com b in es I I m a x im u m stren gth w ith lo n g life. 2 6 ” h igh . In 2 0 rod rolls fo r o n ly ® Per 20 Rod Roll 32 inch high field fencing . . . 20 rod ro ll .................$13.75 39 inch high field fencing ... 20 rod ro ll ...................$15.75 47 inch field fencing . . . 20 rod ro ll .........................- - - $17.75 TOBACCO FARMERS — WELCOME TO ASHEVILLE AND TO LOWE’S — FOR LOW PRICES! North Wilkesboro Hardware h o . NORTH WILKESBORO, N. C. OPPOSITE POST OFFICE PIIONE 389 COM M ON W I E S in all sizes 8 penny to 2^ penny . . . nl LOWE’S LOW PRICE OF . . . .45$ g , Per :00 Lb. K?g THURSDAY, DECEMBER 17, 1953 MORE ABOUT— , IBailey Admits Robberies of this gun opened up the trail for the officers. However, before the officers could track down their lead", two other events occured. On Nov. 18, Bailey’s Store al Pork was broken into nnd three jackets, cigarettes, a battery and other items were taken. Also the next night a rear window on the South side of Mi'ler - Evans Hardware was broken, but no entrance was made. On Thursday night, Nov. 20, Sheriff Tucker and deputies, following up all leads, stopped Charlie Hege of Mocksville, Rt. 3. In his car they found a shot­ gun. Hege told the officers that he got-the gun from a John Camp­ bell’s Grocery Store between Greensboro and Winston-Salem. That he traded an automatic rifle and $15 for the gun. Cooperating fully with the of­ ficers, Hege carried them to Camp- THK MO*’1 sviLUi (N. (J.) ENTERPRISE PAGE SEVEN Seats Theatei YADKINVILLE, N. C. ONE DAY ONLY Thursday, December 17 On Our Stage In PersonLASH LARUE Aisb“BIG LEAGUER” with Edward G, Robinson & Vera El:en Friday, December 18“BIG LEAGUER” Saturday, December 19 Double Feature Program“Lady From Louisana” With John Wayne & Ona Munson Also“APACHE COUNTRY” with Gene Autry. Selected Short Subjects Sunday, .Monday & Tuesday December 20, 21 & 22“THE CADDY” starring" Dean Martin and Jerry Lewis Wednesday, December 23 All Cartoon and Comedy ShowSANTA CLAUS W?LL BE HERE IN PERSON Treats For The Children SUNDAY MOVIES Shows at 1:30 3:00 9:00 Doors Open 1 p.m. and 8:30 p.m Also located at the house was a coa-.ter wagon, which had been painted brown in the attempt to ■amoflauge lt. This wagon was identified as the one coming from ■’rtji Brothels, Also recovered vas a pair of overalls identified as rcming from Livongood’s Store. The following Saturday, with Sheriff Tucker and SBI agents racking down the stolen gum, Oeputies Cook and Milliard God­ bey returned to the Bailey home. They parked their car at some istance from the house and ap­ proached on foot. Bailey, however, •aw them and fled. His parents still denied having seen him .al­ though the officers had received information that he had returned 'iome around 3 a.m. that morn-1 ing. Sunday, Nov. 22, the officers Conned a posse of about ten man and attempted to surround the house. Once again, Bailey fled iust ahead of the ofifcers and posse who unsuccessfully combed the area all afternoon in search of their man. I For the next eight days Bailey’s whereabouts was not known. Of- i ficcrs had received tips that he was in Winston-Sale'm. Warrants were placed in the hands of offi­ cers there and also in Stokes County. On Monday afternoon, Nov. 30, Johnny Bailey was walk­ ing up Trade Street in Winston- Salem. He was pointed out to Winston-Salem policeman and the arrest made. That night he was returned to the Davie Coun­ ty jail by Sheriff .Tucker and God­ bey. Bailey has admitted 19 break- ins and three other unsucessful attempts. He admits the follow­ ing robberies: Bailey’s Store and Livengood,’s Store at Fork; Mar­ tin Brothers (three times); Mill­ er - Evans (twice); Allison-John- son Grocery; Negro Pool Room; Negro Cafe; Davie Lumber Com­ pany; Mocksville High School, all in Mocksville; Louis Miller Service Station (twice); J.. N, Richardson’s at Fork, Cope Ser­ vice Station (twice); Stewart Ser­ vice Station, Etchison Grocery Store at Advance. He admits at­ tempts at Sowers Service Station at Advance, Livengood’s Store at Fork, and Miller-Evans at Mocks­ ville. The officers have recovered the following stolen property: Seven guns stolen from Martin Broth­ ers; three guns from Miller-Evans; rifle from Louis Miller ' Service | Station; rifle from Livengood’s Store; two jackets, pair of gloves, wagon and overalls. Recovery of these items was made as far away as Cherokee County, Randolph County and Mecklenburg County. Bailey admits being nt Miller- Evans on tho night of Nov. 19 and was getting ready to, break-in when a car slowed down. Becom-; ing frightened, Bailey ran and did not return. , I And what about Bailey who is still in the local jail? He is the son of Mr. and Mrs. Note Bailey of Mocksville, Rt. 3. He was born and attended school in Davie County. He worked for a while on the farm of ,S. Clay Williams. Having serious stomach trouble, he was sent to thet hospital in 1949 for a major operation. The Williams family took care of the expense and'Bailey was supposed to return to this farm to work out his hospital expense. However, he is reported to have, worked only a short time and left going to Michigan. ' For the next year or so he got a job as a groomsman and travel­ ed around to the various race tracks. ■ Sometime, around a year ago, he returned to Davie County in an old 1937 Ford coupe. This he reports he sold to a junk man near Winston-Salem. Neighbors did not see much of Johnny Bailey alter his return. Ho stayed in the house mostly during the daytime and come out ouly at night for his escapades. Bailey told officers that when­ ever lie did not wear gloves, he would take off his shoes and put socks on his hands in order to prevent leaving any fingerprints. Most of the time lie walked to the places he broke in. This Would account for leaving some of tho guns in order to return later and pick them up. He admits pulling the wagon load of guns from Martin Brothers. | From money received in the sale of stolen guns, he made down payment on a 1942 Ford at a used car lot in Winston-Salem. . Ofifcers found this car not in an operating condition, at the home of his parents. He admits to a previous record of larcenyy saying that he was put under a suspended sentence in a Winston-Salem court. THE WAGON LOAD OF GUNS was pulled by Johnny Bauey From Martin Brothers to his home, a distance of about six miles. Deputy Sheriff Ransom Cook ,above, looks at one of the guns. The wagn, painted. brown, in an effort to camoulfage it, was recovered- at the Bailty home. (Enterprise Photo). bell's store. Campbell said he had Reavisjnd Perry,were arrested bought the gun from Gray Jenk- and charged with receiving stolen ins, 21st St., Winston-Salem. Jenk- goods. Reavis was put under a $1- ins in turn told the officers he 000 bond and Perry under a $1,- had purchased four guns from, his 500 bond. From their description, father, Bud Jenkins. Bud Jenk- Sheriff Tucker Identified “Bill ins then led the officers to R. L. Smith” as being Johnny Bailey, Reavis and George Perry of Win- 22, son of Mr. and Mrs. Note Bail- ston-Salem from whom he had ey of Mocksville, Rt. 3. The case purchased the guns. ■ had been broken. (Sheriff Tucker stated that On Friday night, Nov. 20, Sher- Charley Hege was in no way im- iff Tucker, Deputy Ransom Cook plicated in the matter and never and SBI agents Thomas and Gar- was under suspicion. Hege co- land, went to the Bailey home, operated fully with the officers Johnny Baily was not there and which led to the solving of the his parents denied knowing his case). ' whereabouts. However, officers Reavis told officers that a “Bill recovered two jackets and a pair Smith” contacted Him on Trade of gloves that had been stolen Street in Winston-Salem about i from the Bailey store 'in Fork. buying guns. Perry came to Davie County in October and bought four guns from this man he knew as “Bill Smith" paying $70 for them. On November 12 the pair bought six guns and a set of barrells, paying $120. Mrs. Bailey, denying all the while any knowledge of Johnny or any of the robberies, wrapped one of the jackets in some newspapers and attempted to throw it under the house. However, it fell at the feet of Deputy Sheriff Cook. Y ou A re Under the New Motor Vehicle Safety Responsibility: law, effective Jan. 1, 1954, you are responsible for the privilege of driving. Protect this privilege and your person and property. Automobile Insurance is your Safest Protection BUY NOW! WE ARE PREPARED TO ISSUE YOU A LOW COST POLICY TODAY ON, OUR EASY PAYMENT PLANy iOur office is open from eight o’clock to five j /rOR ALL YOUR INSURANCE NEEDS, / SEE / / •* ■ E. C. Morris -Insurance/ Agency Salisbury Street Mocksville, N, C. -----Serving the people of Davie County since 1924----- ... '"■SSjsSw j if le v J s m ^ s e s m s ! \ ' j j ip * * " Need Anything for Christmas? You can find it AT Martin Brothers IN MOCKSVILLE !Christmas Candies Fruits and Nuts CHOCOLATE DROPS 25c lb. 5 LAYER RAISINS...............25c lb. Chocolate Covered PEANUTS.....60c Ib.f ENGLISH WALNUTS .....40c & 45c lb. „ | PECANS ....................30c lb.Cocoanut BON BONS..........35c & 45c H, BRAZIL ^........ .....^ KITCHEN CANDY.............35c lb. | Stayman Winesap FRENCH CREAMS..............40c lb. I APPLES $4 $6 bushelS LimbertwigHARD CHRISTMAS MIX.........25c lb. I APPLES ...................$3 per bu. 5Two Pound Box ~ g Delicious . Pure Sugar STICK CANDY 55cg APPLES $5-$6.50 bu. | TANGERINES $3.50 crate y !?Tree-Ripened I Oraii ges| V4 BAG...........—............$1.10 “ CRATE......................... $4.25GUN & HOLSTER SETS.......98c-$3.98| g p0UND BAG 49c DOLLS — DOLL BEDS — DOLL CARRIAGES BLACKBOARDS ERECTOR SETSgTOOL SETS— GAMES *y v _ y ^Complete line of-— If j, TRICYCLES — WAGONS. — TRACTORS AND OTHER WHEEL TOYS “ W YOUU TAKE PRIDE IN GIVING NOMA INDOOR AND OUTDOOR CHRISTMAS TREE LIGHTS I BLANKETS.............$2.19 to $6.50 | WALLRITE.............Big Roll, $2.95 | HUNTING COATS AND PANTS 8.........................FELT HATS...........$3.75 to $4.50 I BLANKET LINED OVERALL JACKETS CONSTRUCTION TOYS.............SHIRTS $5.50 | 9 x 12 Gold Seal MUSICAL INSTRUMENT TOYS E CONGOLEUM RUGS $8.95 TREE DECORATIONS - CARDS TOOL SETS CHRISTMAS MARTIN BROS. Phone 99--“Your Complete Shopping Center Under One Itoof”- -MocksvilJe, N. C. PAGE EIGHT THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 17, 1953" • fi ■> v<; <V A m v V A % V .V » V » W A " A V .W .V A V A V W , 3OCEAN KI’KAV STRAINED ■! J Cranb-erry Sauce j; 303 can 19c ij »u«aouauu»ui LIBKY’S ROSEDALE Z/< CAN V A W .V M V W W V V V W W iW W y W A V r t t t W V W .W 'W iW I A W W A V .T iW W .W W iW iW iW W W W W iV .V .V .'.V V y js %5 Need supplies for your holiday baking? Special treats for holiday entertaining? Quick-5 meal ideas for busy pre-holidays? Then be sure to shop here . . . we’re headquarters for :■ 55 all your holiday food needs, with brand-new, complete stocks in every department. ;j Pear Halves 37c V .- .W .V .'.V .V .V .V .V .'.V .V .V .V .V V A LIBBY’S FINEST l Fruit CocktailIW1 'f ' • VA* J I 303 can - 25c £ V«Vu,. V / . ,,V A V .,.V .V .V .,. V . W V . V . ,1 BAKER’S EXTRA FRESH ’N MOIST LUDEN’S TASTY 2 LBS. Chocolate Drops 2 lbs 49c | Cherries Coconut 19c LUDEN’S PURE 2 LBS « CHOCOLATE COVERED s -Orange Slices 2 lbs 39c S Raisins © A REAL TREAT 2 LBS.100 PER .CENT PURE SUGAR Coconut Buds 2 lbs 67c I f Sw w w v w j v w w v u v ^ v v \ w v f w w u w f l w / w f t v w L \ y . % ^ % w « .v .w .,. p . w w A ,v,\ . W A m w \ m v A v ; 'i i " j w ; w 8 02 pkg 27c 2 LB. BOX 2' lb box 53c YOUNG DOUBLE BREASTED BRONZE EXTRA NICE BIRDS FROM 7 TO 14 POUNDS Toms 20 lbs up 53c lb W .V .V .V .V W .V A W .V A W W .W V V RED CROSS SWEET EARLY June Peas 2 303 cans 27c V .''.n. " . V . V . W . W . V . W V . W . W . ',.%V RED CROSS WHITE SIIOEPEG \ Corn 2 303 cans37c FRESH PLUMP CHICKEN Hens FULLY DRESSED—2 POUND AVERAGE Fryers .......... W .W .V .W J 45c lb 45c lb Fresh Hams, 10 lbs 63c lb V A W . W W A V . ’ . W . W . W A V M LIBBY’S SPICY Pwnpkin 2 303 cans 25c V .V .V A W W .V .V .V .W .V A W iW .V BORDEN’S READY TO USE 28 OZ. JAR Mince Meat 53c V . V . W . W V . ’ . V . W / . V A W A V . V W 4X CONFECTIONERS Sugar 2 pkgs 27c r .'.V V V .W .V A W .V .W .W V A '.W .V . MERITA’S TASTE PLEASING 4 LB. CAKE Fruit Cake $1.69 i . w . w . v . v . m v . ’ . v w . w / . w i . FRESH FRUITS D a iry Fb o d s FLORIDA TREE RIPENED8 lb. BAG.........45c TREE RIPENED SWEET JUICY—LARGE 150 SIZE n Oranges TREE RIPENED SW Tangerineso STAYMAN—RE1 Apples . A W . V .V . W A ’ .V .V-20 lb. ,BAG :...........$1.05 s e a lt e s t t a s t yCRATE ................................... $3.95 $ EGG NOG.......qt. ctn.,'83c 5 Ij KRAFT’S PHILADELPHIA K SEALTEST FRESH Sp WHIPPING CREAM Va pt. 35c ■; "■ A W A W . W A W A W A W i V / A V i V ^ r" i -^fioaai 59c I v”too m w . w . v . v . " . v . STAYMAN—RED WINESAP—FANCY FRUIT5 lb. BAG ....... CREAM CHEESE S; 2—3 oz. packages ......29c £63c—10' lbgB£GfHtT;-....:..... $1.09 \45 lb. BOX..................& L ....... $4.39 5 rMwsAwvjwuwuvMv^^ S"•?........................... ’ «. *1 I W W V W W A W W V A V A '. V A V W m V W W A V W ^ W i W W . W i V V .S V W .V .V .'. W J. !■ KRAFT'S SLICED Full of Milk Coconuts 2 for 35c Large 80 Count Size Fresh Ealmor Jumbo Stalk 1 AMERICAN CHEESE 8 oz. package......BETTY CROCKER— WHITE, YELLOW, DEVIL’S FOOD -35c jj Cake Mixes 1 LB. PACKAGE 27c I........ 2 FOR 29c I; W N V V W W V W .V U V W V W V W W S J V W A V W W w v v w !> BANNER BRANDt MARGARINE .■ DO YOUR BEST BAKING WITHlb., 23c £ Q.jgCO 2 pkgs 69c V W .V .V /.V /A W A V A 3 lb can. 89c P A W W \ W W A V A V .V /W W V V W W m W W A ,A V . V / / . V . W M W y W l W A ,A W A V /A * .W .V A ,. W W , V , V A ,A W ,W ^ J ’. V . V W A 5-m ■ m Minute Maid Frozen Orange Juice j! 2 6 oz cans 45c i Garden Piet Frozen Strawberries 8 oz pkgs 29c ji I s l P ,V .V A % V V V .V .V .V / A V .V .V .n." .V .V .V .V .V .V .V .V .V .'.V , 14 OZ. PKG.£ DROMEDARY FUDGE ji Frosting Mix 31c 5 W . V . W A W . ’ . V / / . V . W A ,. W A ,.V A ,.V .V A ’.V A V /.,.V . J* NESTLE’S TINY 8 OZ. BAG\ Chocolate Morsels.....24c- J il u f ' 0«>C :• s v ieisietg'-sistgtsiswigieietgtsisigigis’eieig’eic's « i f , ,s,s'<ie(s,s!e‘-c«isi« !€•€«’-« «s«!!'ste!c'ei€iets!«'-e!s'««ifvi«!eteie!sicte!eiaigi5i€!€«€,si€ia!e’-sie's'€,2«>e>ais*e'c’-5|€'e<ete,«'e>ciai€l€«!g!€ie'sie’-eie*eieie<s>s!e!eie $9« « HH 3 1 ALL PRICES EFFECTIVE THROUGH DECEMBER 24 ft I 1ft£ % 5f ^ £ a H e f f n e r & B o l i c k G r o c e r y S U P E R M A R K E T ffi UJ€ GlV<E idm -cm m 5Tftm>5 Store Will Be CLOSED Friday, Dec; 25 and Saturday, Dec. 26 i jjr m W w THURSDAY, DECEMBER 17, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE Macedonia The Sunday school will render their Christinas pageant, “The Guiding Star,” Christmas Eve, at 7:30 o’clock. The Yadkin Valley Baptist Church will give their Christmas program Friday night, Dec. 25 at 7:30 o’clock. i Mrs. Mary Hauser suffered a heart attack last week and was helpless for several days. She is improving. Mrs. Frank Sheeks is still con­ fined to her home suffering from brures received from a fall, some weeks ago. ! Mr. and Mrs. Alex Dunn call- - ed on Mrs. Fletcher Strider Fri­ day night. Mrs. Strider is in a critical condition, suffering l'rom tumors. ! The children and grand children gave Mr. and Mrs. Joe Howard a dinner Sunday in honor of their 50th wedding annivesary. Mr. Howard said it was snowing when they were married 50 years ago. This year it was raining. j Pvt. W. Clegg Howard left by plane Saturday afternoon for Oak­ land, Calif., where he will be stationed in Camp Stoneman,; California. | The Moravian Auxiliary met with Mrs. Rosa Riddle on the Yadkin River Road, Thursday night. After the devotionals," Christmas gifts were exchanged and refreshments were served, i Mrs. Ernest Riddle was joint hos­ tess. ' I The Chrr.tmas treat will be. given at Macedonia Moravian Sunday school session Sunday, Dec. 27. Gifts will also be given our from under the tree. Mrs. John Hendrix suffered a stroke while visiting relatives on the Lewisville road last week. As soon as she is able they will bring her to her daughter’ home at Clemmons. Mrs. Chals Walker of Bixby was able to assist in the butcher­ ing last Monday. She is confined to her home and chair. Mr, and Mrs. Willie Fry were Sunday dinner guests of Mr. Gro­ ver Bowden and sisters, Misses Lola and Lettie. Mr. and Mrs. Joe Harding King are moving to Davidson County in the near future, where he will farm for his brother-in-law, Mr. Masencup. Mrs. B. A. (Dock) Smith of Spillman Road has been a hospi­ tal patient this past week. VFW MEETING The VFW meeting will be held on Friday, December 18, at the hut, according to an announce­ ment made by the commander, Clay Allen. All members are urged to attend the meeting. DOLLS 89c to $9.95 DOLL CARRIAGES $2.98-$4.95 BOOKS & GAMES — TEA SETS — TRAIN & CARSNURSING AND DOCTOR KITS ...............59cTOYS FOR ALL AGESS P E C I A L_CHRISTMAS GUM MIX CANDY 19c lb. LOVELIEST GIFT OF ALL . . . Flowers on Christmas Poinsettias Dish Gardens CyclamensMums Begonias Corsages Door Decorations Wreaths Ming Tree Gardens ORDER EARLY! — ORDER TODAY! Davie Florist Phone 222W Wilkesboro Street GIVE HER A LAMP This Christmas- We have them to suit every purse.TOILET GOODS SETS In attractive gift boxes s 8%ft«% TREE LIGHT SETS...$1.19 to $2.98Wreaths — Tinsel —' Tree Balls RELIGIOUS PICTURES— Always a fitting gift aaaaaaaaaaaaaaaaaaaaaaaS iaaaaaaaaaaS taaaaaaaaaaaaaaaaaaaaaS iaaaaaaaaaaaaaaaaaaaaaaaaaS iaaaM iS ill g s £ »We have gifts to suit your budget; Shop here, where the merchandise is not expensive, yet fitting for those gifts you are going to buy. WE APPRECIATE YOUR BUSINESS -This is North Carolina owned Organization- Wallace 5 6* 10c Store North Main Street Mocksville, N. C. Iww iV I Irvin Pontiac Com pany proudly presents PONTIAC 1 9 5 4 We’d like you to see the rich beauty, the clean modern look of the NEW 1954 Pontiac But even more, we want you to experience the unusal power features that make the PONTIAC so easy, so thrilling, so satis­fying to drive.COME IN AND SEE THIS TRULY FINE CAR. .aaaaaaaaaaaaaas&aaaaaaaaaaaaaaaaaaaasiaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaasaaaaaaaaaaaaaaaaaaaaaaaaaaaasi&aaaaaaaaaaaaaaaaaasiaaaaaaaia 1111 This year no fine ear is so important to see, and drive, as PONTIAC- I I i 1 | | I | Truly the only car designed for modern living. See it in our showroom I I 1 I I I I 1 Friday and Saturday, December 18 and 19 I I P iH i ! •' " M M !?!€>«>€ lewis’s i®isi« ,cis's'si€iei5>«,-e!£!a!sic!e'eictcic>2«t5'c's^eisieici€,cicic‘€!eieici€«tc:tE<i«igia Pontiac MOCKSVILLE, N, C. PAGE TWO THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 17, 1953 Farm and Home News —FROM THE COUNTY AND HOMR AGENT’S OFFICE— Listed below arc some suggest- D. Salt, 10 lbs. ed simple home grown grain mix- Note: Where protein meal is tures: lifted above, use either cottonseed 1, With abundance.ot excellent meal, soybean meal or linseed legume roughage: A. Corn and cob meal, 500 lbs. B. Crused oats, 400 lbs. C. Protein Meal, 100 lbs. D. Steamed bone meal, 15 lbs. E. Salt, 10 pounds. •' 2. With medium quality rough meal, which ever is cheapest per pound of protein. A supply of home grown fruits ' is the desire of many families. Some of the most common and easiest small fruits to grow arc age (Mixed grain and' legume or strawberries, blackberries, red poor quality legume hay): j and black raspberries, dewberries,' A. Cor nand cab meal, 500 lbs.' bunch grapes, blueberries and B. Crushed oats, 300 lbs. C. Protein meal, 200 lbs. figs. Apples, pears and peaches also make up many home orch- D, Steamed bone meal, 15 lbs. ard.s All of thc-.e fruits can be! E. Salt, 10 lbs. | grown if proper cultural prac-1 3. With poor quality roughage tices, especialy the control of in-1 (Grass hay, very poor legume or sects and diseases are followed, mixed hay): j Strawberries may be planted, A. Corn and cob meal, 400 lbs. in the fall or early spring. They I E. Crushed oats, 300 lbs. C. Protein meal, 300 lbs. D. Steamed bone meal, 10 lbs. E. Salt,' 10 lbs. ’• 4. On'lush grass legube pasture (If any grain is fel): A. Corn and cob meal, 600 lbs. B. Crushed oats, 400 lbs, C. Steamed bone meal, 15 lbs. should be set 2V& feet apart in 3 or 3% foot rows. Select well-- rooted summer plants for re-1 setting. One hundred plants will supply a family ,of five. The. Massey and Albritton varieties are recommended for this area. , The Carolina variety of black­ berry is recommended. Twenty- five plants will supply a family of five. They may bev planted in the fall or spring and should bo staked. After the crop is harvesi- ted, they are pruned back lo the crown at ground level. They will produce several seasons. Black and red raspberries are best adapted for the mountain area, but may be grown here. Set the plants 4 l'eet apart in 5 foot rows so that the crown is just below ground level. They may be set in latew inter or early spring. Two varieties ■ of blue berries should be grown together for. cross pollination. T.welve plants should be sufficient for an average fam­ ily. Plant in late fall or winter. Space the plants about 6 feet apart in 10,foot rows. Blueberries are attractive and may be used as ornamentals as well as for fruit. They i ntake good borders, backgrounds and screens. Dew berries should be set 5 feet apart in 5 foot rows in the fal lor late winter. Twelve plants will provide enough fruit for an average family. Cultivate to keep the soil loose and weeds and'grass out. Five bunch grape vines are enough grapes for an average family. Some, ofthe leading var­ ieties are Frelonia, Concord, Ni­ agara and Catawba. The two- ■ wire trellis is a good way to, stake bunch grapes. They should bo pruned each winter and spray­ ed 4 or 5 limes during the grow­ ing season. fThc leading varieties of figs are Celeste and Brown Turkey, Set one year old plants 10 feet apart in late ebruary or March., The only pruning necessary on figs is to keep the lop open to sunlight, to remove dead wood and a light heading back if they get out of bounds. I When planting these small fruits, care should be taken to set them in a well prepared seed bed. A good grade of fertilizer used in the recommended amounts. Plants should be or-! dered from a reliable nursery. If you are not ready to set the plants when they arrive from the nur­ sery, they should be heeled in properly until you are ready to set them. m High production from a few cows is more profitable than med­ ium production from many cows. 1 Productionof Grade A milk hr North Carolina during 1953 is up 14.6 er cent over that of 1952. I Be safer on RESIST-A-SKID tread famous exclusive feature of G O O D Y E A R ALL-N YLON CORD DOUBLE EAGLE ANNUAL TAX REPORT $5,331,265.23 .— ***«'•’ * W**0*’ jusf I \x .C . h O T H E STATE AND “LEGAL CONTROL” COUNTIES AND TOWNS in 1 9 5 3 Fiscal Year T h is h u g e $ 5 m illion ta x re v e n u e is th e resu lt o f sta te " le g a l c o n tr o l" b e e r sa le s . O n e -h a lf is re ta in e d b y th e S ta te o f N orth C a r o lin a fo r a n a m o u n t e q u a l to 5 tim es th e in terest o n th e cu rre n t S ta te d e b t— cr, m o r e th a n th e ENTIRE 1 9 5 2 S ta te B o a r d o f H e a lth D e p a rtm e n t e x p e n s e s ! T h e re m a in in g o n e -h a lf (a b o u t $ 2 .5 m illion ) is d is ­ trib u ted O N L Y to th e co u n tie s a n d tow n s in N orth C a r o lin a u sin g th e " le g a l c o n tr o l" system . G e n e r a lly this m o n e y is p la c e d in th eir G e n e r a l F u n d a n d u se d " fo r fire p ro te ctio n , la w e n fo rce m e n t, o ld a g e p e n sio n s, m o n e y to b u ild a n d m a in ta in s ch o o ls a n d h osp ita ls, a n d p a y fo r th e m a n y o th e r s e r v ic e s n e e d e d fo r m o d e rn g o v e rn m e n t. T h e re is n o d o u b t th a t lo c a l a n d sta te ta x e s w o u ld h a v e to b e IN C R E A SE D to m a in ta in p re se n t b u d g e ts if th e b e e r e x c is e . ta x r e v e n u e w e r e ta k e n a w a y . T his is a n o th e r e x a m p le o f h o w b e e r — th e b e v e r a g e o f m o d e r a tio n — p la y s a h a r d -w o r k in g r o le in th e e c o n o m y o f N orth C a r o lin a . 0 . 0 0 7 . B in 01m LrUlflJ State Treasury County Court Houso P .O . B O X 1 2 9 2 Raleigh, N. C, sharp-edged diamond k design grips better — 4 WAYS! • FORWARD • TO THE LEFT • BACKWARD • TO THE RIGHT AVAILABLE NOW! No Installation Charge This original diamond design has hun­ dreds of sharp, road-gripping edges for safer starts and stops ^even when the going is wet and slippery. Be safer- trade slip for grip— trade NOW foB Double Eagles. Davie Auto Parts Wilkesboro Street Mocksville, N. C. M e t - IS T & NOWTake advantage of the many fine Home Furnishing GIFTS At SHEFFIELD FURNITURE COMPANY m 1 sofa beds| tapestry, $44.50« values to 69.50 %« 2 - Tone^ Plastic| NOW $69.50 | Values to g $89.95 1 Platform ROCKERS| plastic and fabric Knee Hole DESKS Mahogany, $49.50 m*m Modern Bedroom Suites, limed-oak and sea- * foam mahogany. 18th Century Bed Room £Suites. Poster Bed Room Suites, starting aslow as.........................$79.50 | «Cavalier $CEDAR CHESTS f Values to $39.95 NOW... $27.50 Values t0'$59.95 NOW .... $47.50 I m 1 hiished in walnut, gblonde waterfall and « /modern limed - oak. g / j]15% to 20% Discount^ “ ^---------DINETTE SUITES—Formica TopsLinoleum Rugs * 19 x 12 ...... $7.95 jjj Plastic covered chairs, from ..... tgtgtgig’etsteietetsieigigictetgtete’g'.eisig *-e«gtet«i£te'S'e,«i3<s,«'etsictg>t:t«'ai<tatc<cte'Cieic‘ctc'etcc‘gie<si£tg'e:e<s<e:ctetgtc^LECTRIC APPLIANCES § HOTPOINT EQUIPMENT IE RADIOS — CLOCKSIRONS-STEAM IRONS g STOVES - REFRIGERATORSors — Toasters — Percolators W DEEP FREEZERS SBf OPEN EVERY NIGHT ’TILL 9 O’CLOCK. SATURDAY ’Till 10 p.m. FROM NOW UNTIL CHRISTMAS Brides To Be — Brides of Today— Brides of Yesterday: SEE OUR SELECTION BEFORE YOU BUY! S H E F F I E L D F U R N IT U R E C O . Route 1, Mocksville At Sheffield ’ THURSDAY, DECEMBER 17, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE PAGE THREE Guidance Program Stressed At D.C.T.S. In carrying out the county guidance objectives as previously outlined for our readers we find the following guidance activities or work at the Davie County County Training School. A time and place has been pro­ vided for counseling. The counse­ lor has a period each day for this work and makes arrangements for appointments at times before and after school. Miss Augusta White is the guidance counselor for this school. Guidance ma'erials such as ■ College catalogues and materials oh careers are made accessible to ■ the pupils. Every high school boy and girl will have an opportunity to go over his or her plans and be giv- ■ en a conference during the year. ' Many of the pupils come for sev­ eral conferences depending on - their needs. The Davie County Training school makes a definite study of drop-outs as outlined by the coun- • ty officials. Each pupil that leaves -school lor any reason is contacted and, if possible, a reason is se- - cured for his dropping out of school. The cumulative record of each • pupil is kept up to date and used :as a guide in the over-all school program. The school has Spring registra- -tion for all high school pupils :and the eighth grades. At this time help is given the pupil in ■deciding upon their high school ■courses of study. Three curricular divisions are offered: (1) College ■preparatory; (2) General; (3) Vo­ cational. , Each year, after a pupil enters high school his credits are check­ ed carefully to see that he is tak­ ing what he needs in order to finish his prescribed course of ■study. Stress is placed upon the care of school property. Principal R. \V. Johnson states that his people are very proud and thankful fori their school plant and the oppor-i tunities that have been provided by the school leaders for the Ne­ gro children of Davie County. High school pupils at the Davie j County .Training School are e n ­ couraged in every way possible to go on to college for further train­ ing if at all possible. The percent­ age going to college is high and many are now takiijg responsible positions that require college ed­ ucations Pupi’s arc not encourag­ ed to reek jobs until every effort has been made to go to college. | In all grades, units of work arej taught stressing the importance and significance of the various professions and voca'.ions. The pupils are taught that oportunit- ies await each person to be of real value to society if properly placed. Along thte same line pu- 1 pils are encouraged to stay in’ their own county and avail them­ selves of the many opportunities here. . i |!. Good manners are stressed by all teachers and all departments. Respect for the rights of others is a constant objective. Along with this, pupils are taught to respect those in authority and to realize that everything possible, is being done for their - benefit.- Principal R. W. Johnson states that he feels DCTS is going forward along this line. j In'erest tests are given to hi'gh rchool boys and girls as requested. A study survey' of all graduates i". being started and a file of these will be made. ' | Each year the school invites Supt. Curtis Price and other. school officials to a meeting of all teachers to talk on guidance and these officials are consulted frequently for advice. Lt. and Mrs. W. H. Byrd of Al­ bany, Ga., were brunch guests of Lt. and Mrs. E. C. LeGrand Mon­ day morning. They were enroute to Bluefield, W. Va., to spend tho holidays. “LET GOD BE TRUE’ By PAUL SIKES Jesus taught h i s dirciples “After this manner therefore pray ye . . . ” (Matt. 6:9). Among the petitions in' the model prayer is one that I want us to consider. “And lead us not into temptation, but deliver us from evil.” (Matt. 6:13). We are never to pray for temptations. Je-us did not pray to be tempted. “Then was Jesus led up of the spirit into the wil­ derness to be tempted of the dev­ il.” (Matt. 4:1). The writer of the Hebrew letter tells us that Jesus wa~. tempted. “For in that he him­ self hath suffered being tempted, he is able to succour them that are tempted.” (Heb. 2:18). We also read that he “was in all points tempted like as we are, yet with­ out sin.” (Heb. 4:15.) “My brethren, count it all joy when ye fail into divers tempta­ tions; knowing this, that the try­ ing of your faith worketh pa­ tience.” (James 1: 2, 3). The word ‘‘fall’ does not carry with it the idea of deliberately casting one­ self down. It is true that when we do fall into temptations that our faith is tried and thus works pa­ tience but we are not to cast our­ selves into temptations. Let us^ read a few more verses concern-. ing temptations. "Blessed is the man that endureth temptation: for when he is tried, he shall receive the crown of life, which the Lord hath promised to them that love him. Let no man say when he is tempted, I am tempted of God: for God cannot be tempted with evil, neither tempeth he any man: But every man is tempted, when is drawn away of his own lust, and enticed. Then when lust hath conceived, it bringeth forth sin, and sin, when it is finished, bring- eth forth death.” Jcmcs 1:12- 15). The Lord knoweth how to de­ liver the godly out of tempta­ tions ...” (II Peter 2:9). The following verse should help us all to overcome temptations. "There hath no temptation taken you but such as is common to man: but God is faithful, who will not suffer you to be tempted above that ye are able; but will with the temptation also make a way to escape, that ye may be able to bear it.” (I Cor. 10:13). adv THE CHURCH OF CIIRISfT Which Meets at Jericho GSA Receives Complaint 011 Land Prices The Gi.neral Services Adminis­ tration has advised that the price of the Yadkin Valley, land'tracts was set as a result of land apprai­ sal conducted by competent and experienced land appraisers. “These land appraisers were furnished by the Farm Credit Administration and did their work-on an entirely impartial ba­ sis and therefore we must accept their values as being fair,” ex­ plained H. E. Harman, Jr., Reg­ ional Director of the GSA. \ft ft I ft ft ftS ft i%NQRTH MAIN ST. SAlisBURY, N.' C .. you JO, This answer was made as Mr. Harmon revealed that the GSA is receiving some complaints from former owners concerning the price at which the land is being offered for sale. Some are say­ ing, for example, that they sold the land to the Government for $1,000 and that the GSA is now asking them, to pay the Govern­ ment $1,200. Mr .Harman pointed out that the present pricfe was based on the present fair market value and that the GSA could not offer this land to the former owners at all unless it was done on the basis of the present fair market value. Harry Osborne and Bob Se- chrest saw "The Robe” in Win­ ston-Salem Saturday night. ‘ Larry Jinks of Greensboro,- was a visitor last week end of W. Q. Grigg, Jr. "T h e best Christmas Savings plan o f a ll. . . plan to use plenty of Smith-Douglass Fertilizer on your next crop!" Smith-Douglass Fertilizer applied to your crops during the coming year at tlic recommended rates is a ’'Christ­mas Savings plan" that will return more than $5 (average value of increased yield) for every $1 you put into S-D Fertilizer. High-quality S-D Fertilizer of the right grade and in the right amount reduces unit produc­ tion cost by increasing yield and quality per acre. Let the nearby S-D Fertilizer representative help you keep your income up!Smitk-ieaglass Fertilizers Listen to OEBNAM VIEWS THE NEWS 12:45*1:00 daffy ft I £ £ft ft ft ft£ i § % g A ft I ON OUR STAGE In Person Lash LaRue One Day Only—THURSDAY, DEC; 17TH g Also on Same Program, Edward G. Robinson 1 in “BIG LEAGUER” Seats Theatre Yadkinville, N. C. ON DISPLAY FRIDAY SlMlMlMlMlkMlBlSaiMtMikSlMlSiagSlMlStMlkMlllMlMlMgkllMlMlMl It’s Back Again This Year HOLIDAY SPECIAL ! 1 I EGGNOG 85c QUART . At Your Favorite SEALTEST Dealer or order from your Distributor Twin Brook Farm P o w e re d fo r P e rfo rm a n ce s E n g in eered fo r Eco n o m y! , with POWER BRAKES, AUTOMATIC WINDOW and SEAT CONTROLS Come see the most beautiful, most powerful Chevrolet ever built. . • the new car that combines great new performance with money-saving gas mileage! In every way, Chevrolet now brings you even more of the things you want. More beauty with brilliant new styling in Body by Fisher and bright new color har- mo.nies outside and inside the car. More power and finer performance with new high-compression engine power in all models. More comforts and conveniences including the richest new interiors in Chevrolet history and such new features as Power Brakes and Automatic, Electric Window and Seat Controls. ’And, thanks to advanced Chevrolet engineer­ ing, all this with new economy, too. The fact is, you’ll find that no other car offers so many things you want at such low cost. That means the low first cost of the lowest-priced line in its field. And it means money-saving economy of operation and upkeep, as well. . Stop in and take a good look at the best- looking Chevrolet you ever saw! 1 1 1 yg Phone 94 Mocksville, N. C, g x y§ wK«!eie<ete«<e<s<e<s<e‘e‘c<eie*ie<cie«<e'.e:e!e<£!e<eseis«e!etj«:!e«««!e*i6icie!aic!e«;t«ig!« Power brakes for easier stops Now Chevrolet brings you Power Brakes to make stopping wonder­ fully easy and convenient. Optional on Powerglide models at extra cost. New, automatic window and seat controls The touch of a button adjusts front seat and windows. Optional on Bel Air and “Two-Ten” models at extra cost. Mora things more people want, that's why M O R E P EO P LE BUY CH EV R O LETS THAN A N Y O TH ER C A R ! New styling that will stay new There’s a new, lower, smarter look about this new Chevrolet. All around the car, you’ll see new styling that brings you Fisher Body at its beautiful best. New interior richness Fine new upholstery fab­ rics with a more liberal use of beautiful, durable vinyl trim. New color treatments in harmony with the brilliant new exterior colors. Thrifty new power in all models Now, in Powerglide mod­ els, is the more powerful "Blue-Flame 125” en­ gine. Gearshift models offer the more powerful "Blue-Flame 115." SYMBOL OF SAVINGS New, lower price on power steering Chevrolet Power Steering now reduced in price! It does 80% of the work to give you easy, sure control. Optional at extra cost on all models, E M B L E M O F E X C E L L E N C E Pennington Chevrolet Co., Inc. PHONE 156 MOCKSVILLE, N. C. THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 17, 1953 FARM PRICESUMMARY F u n| closed weak at 24 cents per pound I f.o.b. tlie farm. Heavy hens were | steady and ranged from 25 to 27 Editor’s Note: Following is a [cents. Closing farm pay in the summary of market price infor- Shenandoah Valley were reported mation for the week ending Dec. 4, 1953, as gathered and edited by the Market News Service, N. C. Departmen of Agriculture. , The 1,953 selling season on the Eggs were steady to 2 — . Middle Belt flue-cured tobacco lower in Raleigh with local grad- cl“ ';.c_h ■markets ended Dec. 11. Demand 'mS stations paying 58 to 62 cents e r a Is Mrs. R. L. Smith, 59 Funeral services for Mrs. Rob- Church. Rev. J. P. Davis officiat- 1 ed. I The infant died early Monday morning in a Salisbury hospital. Surviving are the parents; one Turkey Foot Mrs. M. O. Renegar, Mrs. R. at 19 to 20 cents and in the North ert L- 5?’ of Mocksville r.ister, Ronnie Yvonne Mabe, and c . Foster and Miss Duo Shaw, at- Georgia area at 22 to 23»/z cents. were h®'d Tuesday ;at the Beth-jthe grandparents, H. W. Mabe of tended the Christmas-party given1 nu Rfl inf f 114«« mam iKn _ • ■ * « * • « » « ■ m 1In the Delmarva section, closing lehem Methodist Church by the Tam]js and Mr .and Mrs. J. P. by the Home Demonstration club prices ranged from 18 to 22 cents. Rev' Goorgc Smith and Rev. williams of Stephens, Ga. cents George Bruner. Burial was in the Mrs'. Smith died at her home Mrs. Rena Boger, 69 Funeral services for Mrs. Rena at Harmony Friday. Mrs. Mattie West and daughter, Mrs. Wilber Walker, visited Mrs. Hepler Boger, 69, were held1 last Fay Reavis Wednesday. . th,«l wo.k A, b w , 49 to S. for A, mod- £ “ “ “ “ f ” ' W .in esJ,, a. lh« Union Ch.po. Mr. , nd Mr.. M a ™ . * ■ ot sales ■ ond o m.Jorily ol 48 <• 44 ArJ , Molhodl!* Churel’ ' Th? W' «d Mr. .nd Mrs. O t a . Show and ■vvas great majority ot ’ im dent of Mocksville for the past•average prices by grades declin-|Eg?s were unchanged in Durham ed. Volume of offerings was light rents’ iT d r n n A The former Grace Elizabethand quality of marketings poor. a*- 55 *-° cents per dozen. A, Gross sales for the season Thursday,, Dec, 10, amounted to a little over 136 V2 . million pounds, averaging 47.11. t h i S mediums at 45 to 46; and B, large Punn’ Smith is su™ ved home,of a son, G.,A. Boger, Rt. inroutn , .her husband; a son. Alton Mi „ __,______________________at 52 to 55. C. Anderson and Rev. E. M. Avett family, and Mrs. Cora Smith at officiated. the Shaw home Sunday Mrs. Boger died Dec. 8 at the Mr ana Mrs sherman Rene. gar and family of Hamptonville, Dinner was served to the fol­ lowing: Mr. and Mrs. J. G. All­ good and Hurley Hoots of Yad- kinviile; Mr .and Mrs., A. W. Laird, Mr. and Mrs. A. M. Laird, Mr. and Mrs. A. F. Laird and fam­ ily, Mr. and Mrs. J. W. Laird and family, Mr and Mrs. E, Tid-Bits By GORDON TOMLINSON A new wrinkle in rabbit hunt- A. Ray-; jng was adopted by two Davie buck, Mrs. R. R. Couch and son, I County men recently all of Advance, Rt. 1; Mr. and' Mrs. J .H. Brock, and Mrs. Ir­ vin Allen of Farmington, Mr. and Mrs. Ray Myers and son of Win- ston-Salem;; Mr .and Mrs. V. G. Foster, Mr. and Mrs. John R. Smith and son of Mocksville, Rt. ' Smith of Greensboro; a daugh-1 jjjnggg Shel’ed corn prices were steady ter, Mrs. Sarah Bingham of Clem-1 2, Mocksville, following a long ! to slightly stronger at local mar- mons; two brothers, W. O. and C.1 Mr".. Boger was born in David- Pallbearers were J. W. Rodwell, No definite trend was observed kets during the week. No. 2, yell. S. Dunn, both of Route 1, Ad-1 son <T°unty’ ,ATug' 4’ J®84, daUAg,1?' in average prices for Old Belt ow cnrn ranged rom 1.50 to 1.65 vance; two grandchildren. Itw n * 'nvmn ' nn flue-cured tobacco this week with |n the piedmont and from 1.45 to gains and los-es about equally 1-Rg in the eastern area. No. 2 divided. Quality of offerings was Mr. and Mrs. Fred Wooten of County Line, visited Mr. and Mrs. M. O. Renegar and son Sunday afternoon. „ , . _ Rock Springs WMS will meeten Hepler. Her husband, Jesse uh Mrs_ R D Smith Thursday Coe .Boger, died in 1933. night gnd hav£ theh. christmas Surviving are four sons, Thom-* . r Y; B^ lG!,’ G:enn Hammer and, f 0f M? * 8V“ le; f OUtn ' Mr.' and Mrs. Earl BumgarnerGrady Ward. K Hal C Boger of Fork; John C have moved to their home near ------------- Boger of Huntsville, Ala., and Lexineton Roscoe Auily Mabe . | G. A. Boger of Mocksville, Rt. ‘ v Gravesic'e services for Roscoe .2; two daughters, Mrs. R. G. Mot-j A 3C Zaro E. Foster, Big ... , . . , . Jr., Joe Foster. R. P. Martin, Jr.,white corn was ouoted at 1.60 in ’ not quite as good because of a tbe piedmont and at 1.40 to 1.50 small increase in nondescript. eastern sections. Soybeans Volume wan. fairly light. Season were mostly steady during the sales through Thursday amounted with prices ranging rom 2.80 to just over 227 million pounds g Rf] o°r bushel ^Vheat oats for an average of 42.23 per hun- and ' ’ n ' \vsre‘ generally steady Audy ™*be' lnfant son of Roscoe le^ of Salisbury and Mrs.’ Denner Springs, Texas, was honored at dred.with No. ?. red w'iwinter "wheat anc' k'H'e Williams Mabe'of Rt. Robinson of Burnsville;.22 grand- a turkey dinner, Sunday, Dec. A strong hog market moved up ' br;ne;na 2 00 to 2 10'inThe'pied- *’ Mocksvil,e- were held Tues: children and two great-grandchil- 13, at the home of his parents, again this week at local hog buy- mont s^ction and‘No. 2 red oats day at the Center Methodist dren- _ Mr- and Mrs. R- c - Foster- ing stations and prices for top hogs ,.nm pf) cjq cents per bu-hel. No. »ista3iai»i2isisiaa3tsisiaaaa3iaaa2tasi3ia3iaiaisiasisiasiaaaaaaaa3)9i3isisi)aasi&iasi)9isj2!asi2i2isi3is!aa9!si3isisi3isisi&ias)a3isisaas)aaa^aaia3)aaaaaaaaiiaasi3!siaaaasiasisi»i3isi: v-ere 25 to 50 cent."- higher per j veltow milo pj-ices closed at $5 1. Zaro will enter Officer’s Can­ didate school in San Antonio, Tex­ as, December 28. BIBLE CLASS ENTERTAINS On Friday evening, Dec. 11, about 80 persons, including mem­ bers and their families, and friends of the Horn Bible Class met for their annual Christmas supper in the basement of the Baptist Church. The supper con­ sisted of turkey with all trimm­ ings and was prepared by some of the members’ wives. A special program of Christmas music wa3 rendered by Miss Marcle Thomas and Miss Mary Turner. The story goes that Frank James and Oscar Cook of Mocks­ ville, Route 4, wanted to go rab­ bit hunting. It is said that they had about ten dogs, but the dogs would not jump a rabbit. The other day the two men were seen walking through a field, some distance apart, dragg­ ing a chain betwen them. Follow­ ing along at their heels were the dogs. They were successful, for suddenly they jumped a rabbit. However, in the ensuing excite­ ment both shot and both—missed. Neil Bolton told the Rotarians Tuesday of the farm girl that said that the calves at her farm were the result of artificial in­ spiration. Use An Enterprise Want Ad hundred pounds! Closing prices 2 25 to 2 50 per h"ndred pounds. ranged from 22.50 to 23.50. Most . « markets .however, reported top •c,,^ “t • ootatoes were dull on « hogs nt 23.00 to 23.50 per hundred t.he New York market at the close « pounds. On the Chicago market, of the week. Bushels of U.S. No. « bngs moved up (10 cents per hun- 1 Porto Ricpns ranged from 3.25 | dred to close with a top of 24.50. to 4.0(1. Cabbage were weak at js C a t t le prices were steady on the the close in Mew York with one a Rich Square and Rocky Mount and1 three-fourths bushel crates K Auctions this week. Fat butcher of domestic round type from this fjj beef cows brought 9.00 to 10.50; state wholesaling at 1.00 to 1.25. « good fat heifers 14.00 to 15.50;j Pecand pr{ces ,VGre steady in'| and good fat vealers 24.00 to 26. | Uumberton - with No, j Stuarts jj Medium to good butcher- steers bringing „ cents per pound; No. g ranged from 19.00 to 20.00 and 2 gt ^ Seedu u J good fat butcher bulls from 11.00 tQ lg cents; ■ jg to 12.50. Cattle prices in Chicago | ' (ft were weaker this week with steers Spot cotton prices continued to' j| and yearlings 50 to 1.00 lower. | fluctuate within a narrow range' ^ Prime heifers were also 50 to 1.00 this week. Middling 15/16 inch « lower. Utility and commercial ] averaged 32.51 cents per pound on gs, ™ ®cows were 25 to 1.00 lower. Choice( Friday. This compares with 32.66: H and prime fed steers brought 25.-1 last Friday and 33.56 on the cor- ' 50 to 30.00 and commercial and, responding date a year ago. #5 low grades 14.00 to 16.50. Utility j —------------------------------------------- and commercial cows ranged from GARBAGE COLLECTION 9.50 to 12.00 and canners and: The Town of Mocksville will ^ cutters from 8.50 to 10.00. Good pickup garbage and trash next; K fat bulls brought 10.00 to 11.50. | week on Thursday instead of Fri- Fryers and broilers were one day. cent lower in the Central North | — :-----------------------------— ........ Carolina are and the market again • IT PAYS TO ADVERTISE How to be a Better Cook ... and save m or.ey tool te e . laaasj* o o k | 'oo* I - a s A dvertised in U F E ^ ) j (Z a H V ltiO M A t (Makes tingle crust 9" Pie) 1 cup iugor IVj teaipoont cinnamon Vi t*o»poon clove* Va teoipooM otltpic*(MlpOOflnutmeg Vl t«o*poon ginger Vj toatpoon Milt 2 eggi H/j cup* conned pumpkin <»/j No. 2V*| can) l^ i cupi (large con) undiluted Carnation Evaporated Milk ♦•inch tingle crutt unbaked pie ihell S ia a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a si Say'Merry Christmas' ■fo ihe whole fymily withAN ELECTRICAL GIFT General Mills and Universal SMALL APPLIANCES Deep Fryer—Toaster Waffle Iron Electric Mixer Popcorn Popper Coffee Maker Lewyt Sweepers RAYTHEON TV SETS, as low as..$179.95Tele King and Dumont Table and Console TV SETS lh& Qtil1/ A«*fowafcto uiiik Double SpinTubsi I Sets eipihes desneri -ff\Qj MAYTAG ^ a to m a fie / \A/ashe/r $299.95 Your old washer may be worth a big down payment! ! i& c t r a £ TU RKEYS Tom Turkeys 55c•/PLACE YOUR ORDERS THIS WEEK Fryers, young and tender 39c lb Pork Chops 59c lb Pork Liver 29c lbs. , . . . ' , k \ Pork Sausage ^ 39c lb Combine ill ingredient* until smooth. Place in pie shell. Bake in hot oven <425® F.) I ) minutes; lower tem* perature to moderate oven (350® F.) Continue baking about 55 minutes or until custard is Arm. Cool, top with whipped Carnation. To whip Carnation chill Vi cup undi* luted Carnation in refrigerator tray until soft crystals form around edges of tray (about 10-15 minutes). W hip \until stiff (about I minute); add 1 tablespoon lemon juice and continue w hipping until very stiff (about I minute longer). Add sugar to taste. Serve immediately on cooled pumpkin pic. Monte ia aVss V svVVV g gVV Cand^^uro^ Blue Bird or Red Bird STICK CANDY 2 lbs 55c CHOCOLATE DROPS1: lb. bag A.........29c PECANS OR ENGLISH WALNUTS 2 lb. bag; .................69c ~yegmbW J anft attthe trimming# TWO FIRM HEADS X A K * a «A X K KaK H H « a a a9 u-si i a R « C. J. Angell Appliance Co. | Phone 60 On The Square Lettuce 29c Tomatoes 23c lb Oranges 5 lb bag 29c u. s. NO. 1 Potatoes 10 lbs 29c SUPERFINE Peas 23c can Asparagus Spears 35c can RED CROSS—SHOE PEG Corn 19c can SOUR OR DILL— Vi GALLON SIZE Pickles DUKE’S PINT SIZE 55c Mayonnaise 33c aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa DEL MONTE—303 CAN Pear Halves 27c aaaaaaaaaaaaaaaaaas.aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaas.aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa LUZIANNE—RED LABEL Coffee 64c lb WITH MAIL COUPON /dating, i JOHNSON’S HARD GLOSS Floor Wax 89c REGULAR 98c VALUE reame, i B uy/ / tztztz<z<ziztzt6)€<z‘z<z<z<5iz<stz<z'<'zig'-s<z’st&<s'€<e>eis<z'e,-e<€<€<etei&<€iei£<£<G<€is<si£<ete)gts>steteiett:‘S‘e<c<eik’ctet&ie<e>e)s<gte>sieisi&iets<s’e<sie‘e<e‘eteis<sis<e>stetei€‘stetz>cicteieivciti6<&<z>s<eteitite<eieiate<e<e>*<ZKtt WEST END GROCEBY !e!£is,s's«’-£«|s « !e,« ,£’'®'«'e|s,e’2!s's>£«,-c«'e,-e'£‘e<s,e<sie!£!e«!gte>-6i*t£tetetetetc!eis!4!ets‘s>e<e‘e««6<e<e'e<eieic<c«<« MOCKSVILLE, N. C. g ttt ttttt r frttt i IggV ¥i I¥&pw 1 THURSDAY, DECEMBER 17, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE * spent Sunday night with Hr. and!• I her parents, ivir. ana m x s , j . in. meeting was 10 maKe pians ior ai i wgiu wuu mi, uuu, Alma Lee Barney is improving I T p 1 Richardson. R. A. Congress to be held in the] Is Mrs. Lawrence 'Williams. jat her home after a recent ill- I I / 0 1 * K . i Mr. and Mrs. Hal Boger had as Spring. | P i |1 Helen and Mory Lois Jo"cs v's- nesi. I j ti.ni- guest tor supper Saturday Visitors of Mr. and Mrs. Robio .... j iied E.la Willian.s at Rowan Me- Airs, Floyd Frye has returned Thursday afternoon of this night,, Mr. and Mrs. Allen Boger Jarvis Sunday were Mr. and Mrs.j Mr. and Mrs. W. N. Jmes made, 'norial Ilor.pital Sunday. j from the Baptist Hospital but is Week the Woman”s Auxiliary will of Mocksville; Mr. and Mrs. Den- Wade Jarvis of Thomasville and a busincs trip to Salisbury Tues- Elsie Bowens and Betty Jo confined to her room, meet with Mrs. John Sanford at' vcr Roberson and children of Mr. and Mrs. Grover Robertson day afternoon. j Bowens shopped in Mocksville Mr. and Mrs. Norman Smith 3 o’clock. Miss Bettie Gordon of Spray will give the program on Missionary work. Miss Gladys Hendrix of Greens­ boro spent the week end at home with her* parents, Mr. and Mrs. A. E. Hendrix. Mrs. Tom Foster of Winston- Salem spent Thursday here with her sister, Mrs. J. .C. Rattz. Mr. and Mrs. Peter Hairston, Jr., and sons, George and Peter, spent,Sunday in Raleigh visiting relatives. Mrs. Otis Boles and daughter, Joy, of Severena Park, Md. are spending some time here with Burnsville and John C. Boger of of Lexington. Huntsville, Ala. | Guestg of M Ethcl H Sunday guests of Mr. and Mrs.1 g were Mp_ and Mfs Ho,..s John Parks were Mr. and Mrs. Hoge of MooresviUe. ^ and Mrs. Ralph Hege of Welcome' and Mrs. Maude Chaffin of Woodleaf. Sgt. and Mrs. Glenn Allen Mot­ ley of California were Sunday dinner guests of Mr. and Mrs. H. C. Boger Gaither Shoaf and children of Lexington, and Mr. and Mrs. Frank Miller and Bob Miller of Turrentine. Mr. and Mrs. Everett Richard­ son and family, and Mr. and Mrs spent Saturday night with Mr. and Mrs. Calvin Barney. Mr. and Mrs. Otis McEverette and daughter of Welcome visited Mr. and Mrs. Joe Allen recently. IT PAYS TO ADVERTISE visited 't nd Mrs” ' Law r enco ■ Mrs^Eugene Bennett Visited Williams Thursday night.Helen Jnnes Monday afternoon. Billy'Potts ‘ made" a "business I „ Mrs' n ^ m d Bennett visited g trip to S. C. Saturday.Q.Mrs. J Barbara Potts spent Friday mBht. night with Peggy Cornatzer.. , . . . . a Helen Jones and Ella Jones patlent at Yadkinville hospital, « Williams Saturday ft « Norman Smith who has been a jj shopped in Winston-Salem Thurs-,mproving. . v « . w. jjusa-. day- | Rev. and Mrs. Tommy Flynn {5 i s ,° j* ? ” ’ ‘ .lu'i Mr. and Mrs. Harry Hartley 1 Reba Jones and Mary Lois were Sunday dinner guests of S spent the wee en ere wi an(j children of Welcome were Williams spent .Thursday in Sal- Aaron Carter. relatives The Rev A. M. Kiser spent Sunday guests of Mr. and Mrs. J isbury. Tom Rice. Mrs. George Jones who is indis- « Ruth Williams of Mocksville posed is improving. For the BEST in D ry CleaningClothes Dyed — Knitted Garments Blocked. GIVE US A TRY TODAY ■ Wade’s Dry CleaningDepot Street Mocksville, N. C. S ti'e'ctc'eigtctctetg'etete'ctgtc'ctetetctg'C'ctcte'etgtctc'ctctetg'c'ctctctetg'ctcietcicteKtcicwMonday in Shelby attending a _______________________________________________________________________________________________________________________________________________________________________________ r.pecial meeting of Associational *1*1 si****)*i*»t»>»iMisiftfcSiaiSiaifeSiSiSiKSiatftSiftkkiiiSikfeftMkftkkSikkMkMiifeftftMiiikiisikygfeigftlikltM Officers. The purpose of the * ____________________________________ « AN ENSEMBLE THAT WILL GIVE YOU EVERY CON­VENIENCE YOU NEED AT A PRICE YOU CAN AFFORD. NATIONAL’S 22" x 18" genuine vitreous china lavatory with shelf and two soap receptacles. Completely equipped with chromed mixing faucets, mechanical waste, legs and towel bars. NATIONAL’S close-coupled stain proof vitreous china wash- down closet combination with solid Benzite seat and cover. NATIONAL’S S ft. lifetime cast-iron recess tub, full 16" high, with tub filler- chromcd spout and trip lever waste. A truly ideal combination that will give you years of satis­ faction. You can have terms to suit your budget. As low as $5 a week 5 ANF0 HD-MANDD CO.% 'ftmbiAUi ~£&jdnica£fi/mluiHGU. S A L E S * SERVICE MOCKSVILLE, N.C. ........................ PHONE 175 llMl»lSl»lSlSl»&3l3i3l»3iS;aSl2lSl3i»&SlSOsSl3iasSiai2l»S»!Sl2l»iSl»iS!3lSiS!Sl3i3l»2!3[j HURRY------HURRY OUT TO SEE US DURING OUR Pre-Christmas Sale —BARGAINS GALORE- ALL MATERIALS REDUCED. YOU WONT g f WANT TO MISS THESE BARGAINS! ic>c>c>s'e'ctc!c|sts!e<£|<’« !e|c|<1cc'6'e'e<s>-e<e:tc<e'«'C'stc'e'<‘C‘£«‘<%*£'e«|c1etG 5 1 « 1DON’T FORGET TO REGISTER for the Material that is to be given away, Saturday, December 16. Mrs. Lula Boger won the material we gave away last week. Terry Cloth 5 SPECIAL SPECIAL 59c «'cm «w e«'c'c'cie<c|c g first quality S I Nylon HOSE g $ 79c pair 2 Cotton Gabardine Was 69c Sale Price g 49c ?45 inches wide |Bur-Mill | 60 gauSe Rayon Suiting % 15 denierWas 97c | This sale only | ISale Price limited supplyg was 79c 79c "Get yours now; Sale Price69c45 inches wide^ V w jeieigigieigigieisigisigigie^y y yLinings Was 59c Sale Price 49c yyyyvy Rayon Flannel Was 79c &45 inches wide sS y y yy Dan River | Cotton Tweed | I 39c *|A real bargainSale Price59c ____| 40 inches widej45 inches widej?4i inches wide * g y For Belting — Buckles to Cpver — Eyelets— Thread — Zippers — Seam Binding — Pins Shoulder Pads — Shirt Facing, etc, its . . . 1 f%£ The Remnant Shop Yadkinville Road Mocksville, N. C. yljt B'9 _srr« K«ieteieie>e‘ete<e>e<s<e>e>e1e>e>e>e|s>e>e>e<«;>£teieieieieteie%te!etetEieietstc!eigtetsieKc'<t« PAGE SIX THE MOCKSVILLE (N. C.) ENTERPRISE »Si3l9tSl3!ai3l3i£)3l>gSl%9l9l9i2l2i|3l9lSl9lS)3lSlXlS)S<»lSlSl»at3l9i>l9t9]»Sl>lMaiSt9lM)GIVE Lovely Nylon Lingerie THE PERFECT GIFT from MOTHER AND DAUGHTER FASHIONSin Winston-SalemWe’ve a glamorous collection of beautiful, nylon tricot undies—gowns from $.5.98, panties from $1. Petticoats from $2.98 and slips from $2.98.| All purchases boxed and gift wrapped free Rev. A. C. Cheshire Accepts Pastorate Of Yadkin Church m m a B u u v m fmkioss *Corner Liberty and Third Streets In Winston-Salem 1 i £ a I iA jS Rev. A. C. Cheshire has accept­ ed the pastorate of the South Oak Ridge Baptist Church in Yadkin County. He succeeds the Rev. H, Wade Hutchens. For the past two and one-half years, Mr. Cheshire has served as pastor of the Farmington Bap­ tist Church. Other churches served by Mr. Cheshire over a period of ten years has, been Beulah Baptist Church, States­ ville, Rt. 6; Courtney Baptist Church; Advance Baptist Church and Bear Creek Baptist Church. Also he is currently serving as pastor of the Yadkin Valley Bap­ tist Church in Davie County. Mr. Cheshire served as a miss­ ionary pastor under the direction of the State Mission Board of the State Baptist Convention for a period of five and one-helf years. Mr. Cheshire is employed at the Heritage Furniture Company in Mocksville and plans to con­ tinue his residence on 1226 Bing­ ham Street in Mocksville. R. H. Neal of Charlotte, and Mr. and Mrs. H. H. Neal of Mad­ ison were week end guests of Mrs. Neal and Mr. and Mrs. C. J Angell. THURSDAY, DECEMBER 17, 1953 Lenora Dodd Circle Enjoys Yule Meeting The Lenora Dodd Circle held their Christmas meeting on Dec. 8, in the Young People’s Depart­ ment of the First Baptist church. ■The rooms were decorated with Christmas greenery, magnolia fol­ iage, red berries and red candles. “Keeping Christ In Christmas” was -presented by Mrs. J. B. Hill, Mrs. Gene -Neal and Mrs. J. M. Horn. The chairman, Mrs. Norman Rummage, presided at the busi­ ness session after which the hos­ tesses, Mrs. E. G. Hendricks and Mrs. Fred Long served fruit cake, cheese wafers, decorated Christ­ mas cakes and coffee to 19 mem­ bers and six visitors, Mrs. J. P. Davis and daughter, Rebecca; Mrs. J. L. Holton, Mirs. Gene Neal, Mrs'. B. R. Steleman and Mrs. R. W. Collette of Winston-Salem. John Larew of Schenectady, N. Y., arrived Thursday to visit his mother, Mrs; J. J. Larew, and brother, Hugh Larew, until Sun­ day. Mr. Larew was enroute home from a GE business trip to Kansas City, Mo. P O N T IA C P R E S E N T S A C o m p le te ly N e w l i n e o f A u t o m o b ile s ! FOR 1954 T h e N e w L A i G f j - ^ e H e t - B r i n g i n g S i e w V a l u e s i n L u x u r j r S iz e a n d P e r f o r m a n c e I S c v e r B e f o r e O f f e r e d a t t h e I * r ic e S Biggest Pontine Ever BuiU -211 Inches Over-All Length Magnificent New Beauty, InHlde And Oat New CuMtom-Styled Interlorw—New Exterior Colors - M«Nt Powerful Pontiac liver Built New nonliability And Driving Ease New, Greatly Increased CroKS-Country Luggage Boom TO ADD TO yOUR DRIVING PLEASURE .AND THE LONG-RANGE VALUE OF YOUR CAR— PONTIAC OFFERS A WIDE SELECTION OF OPTIONftl EQUIPMENT* llcre i» the first genuine luxury car ever to be offered in Pontiac's law price range! An the biggest I’ontiac ever built, the new Star Chief brings you all the generous added length required for peak roadability and riding ease. Ami this extra lengtli provides a long, low, aristocratic silhouette like costly cars, brought lo even greater beauty by a brilliant new treatment of I’onliac’s exclusive Silver Streak. Interiors are in key. Ilere is tiie gracious, spacious look of luxury for which motorists have paid several thousands more than the modest cost of the new Star ChV-f. Adtl to all this an even mightier IV..i!vic en­ gine and yon will understand why you should not only sec, but drive, ibis magnificent . new, car soon. See the completely licw Star Chief ibis week­ end, along with the wonderfully improved Chieftain Series—General Motors lowest priced eight and famous economy six. To­ gether, they prove lhal whatever you prize most in a car, again in ’54, dollar for dollar— you can't beat a Pontiac. Dual-Range Hydra-Matleprovides instant response in traffic, extra-aconomicat cruis­ing tor the open road. Po»tl#e’« Power Steering offers (infer tip steering ease tor parking and slow ImnlnB, yet you retain safe loaii jcel, New Air*Conditionlng cools your car to the tempera* turn you set in minutes. Eight cylinder tiiodeis o.iiy. New Pontiic Power Brakes tet you stop factor with tat less effort and foot movement. A major advance in safety. New Electric Window Lifts raise or lower front windows to any desired height by simply touching a button. •Optional equipment and accessories available at extra cost. New Comfert*Control teitadjusts to 3G0 different seat angles at a touch for the best driving position. N o BV - with its Beautiful New Companion Car T H E SM JV ER S'STfllEAK. C M IE FT A IW BJOUS5JLE3 P R O O F TBB'A'IT ©OBJLAB*. B^OBl S501XA BI Y O U B M 1 ' A J P fa f& t M S i'C m Irvin Pontiac Company Wilkesboro St.Phone 35 Mocksville ‘I’m giving you a well trained maid for Christmas. She’ll work for you many years and you won’t have any trouble with her!” How would you like to say that to everyone on your Christmas list? Today you can give such a gift ... by giving an electrical servant. Elec­ trical appliances make daily activities more pleasant for every one in the family. May we offer you the following suggestions of items available at our store . . . General Electric TRIPLE - WHIP MIXER $44.95 te<g«<etc««<etCK<e!etc««tc'etciete!eteiCiete!ct<te«te'eicic«General Electric SANDWICH GRILL $16.95 tc'e'.octgietcteteteteietetcte'etstetetgtetetcictetetcictctcieicicwGeneral ElectricSwivel Type VACUUM CLEANER $89.95 t«tetsi«!5t6tetstet«ieiei«teieietgtei«isiaisie!e«tetet«<c*«eic«*Doremeyer ELECTRIC DEEP FRYER $29.95 Motorola RADIO & RECORD PLAYER COMBINATION $99.95 te « ie!g«te igieiMie’-sts « te ie*'-eie!et*tc tete«t«!CSymphonic ELECTRIC PHONOGRAPH $22.95 IWCWMIWtWMlMWCtMWiMWMtMlCIMWCfOMGeneral Electric AUTOMATIC IRONS $12.95 STEAM IRONS...$18.95 K w m m m iM iM iM ififm iK xia m icifvtM iM m vGeneral Electric Automatic POP-UP TOASTERS $23.95 Complete line of -H O T POINT- sv HOUSEHOLD APPLIANCES aalMiJiJiaiMiaiSlliMifcOTi*!******!***!**!****!*!**!****!***!* COMPLETE LINE OF FURNITURE AND HOUSEHOLD FURNISHINGS Assorted Lamps — Tables — Chairs — etc. Step-On Garbage Cans $6.95 Full line of Lane CEDAR CHESTS $49.95 t«!«teieteietc>e>etcteietciete«tet«ie>etetetetetete!ete%tetetetctete<ststet:tei«:ic«tc g D a n i e l Furniture & Electric Co.PHONE 198 MOCKSVILLE, N. C. THURSDAY, DECEMBER 17, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE FHS Echos By SHERRILL BRINKLEY & EMMA SUE ALLEK On (Tuesday night of this week Farmington and Rockwell clash­ ed, in the Rockwell gym. Everyone at Farmington is looking forward to Friday night when we have our first home- ■ coming game. In this game' the Farmington Blue Devils take on Rockwell again. This is a new en­ counter for FHS, but we are "looking forward to a great time. . A queen will be crowned at half- • time of the boys game by co-cap­ tains Johnny Boger and Bill Wal- ' ker. Two candidates from each high school grade were chosen to run in the election for queen. The ^queen is to be selected by the ball teams from one of the following: Marie Absher and Winifred Da­ vis, freshman class; Peggy Coe . and Jean Sharpe, sophomore class; Dorothy Reavis and Jo Ann Boles, junior class; Betty Carter and Peggy Davis, senior class. All former ball players of FHS will be admitted free; so everyone come and-make this game a suc- • cess. The Beta Club -.met Monday night to talk over plans for the " home-coming game. Tuesday night of last week saw 1’Farmington in Cleveland for two return games. And again the Blue Devils showed their stuff by com­ ing home victorious. The girls set the Rowan County champions back 47 to 28. The boys gave Cleveland their second defeat of the season, in a real thriller, by a score of 55 to 45. Coach Dull’s girls got an early lead and held it throughout most of the game'. Cleveland threatened in the latter part of the third quarter, but the Blue Devils, with Emma Sue Allen finding range, walked off and left Cleveland in the' fourth qaurter. Emma Sue had 29 points to lead the Blue Devils scoring, while Jo Ann Boles and Dorothy Reavis collect­ ed 10 and 8 points respectively. The guards, with Mary Lillian Pilcher doing a great job on re­ bounds and Rachel Langston and Bessie Seats keeping the Cleve­ land forwards out from, under the basket, played one of their, better games. The boys jumped to an early lead and held it until the latter part of the third quarter, when the action really began. Cleveland racked up a 5 point lead in this quarter; but the Blue Devils cut it to 2 points by the time the bell‘ rang. In the fourth quarter Stanfield’s men really poured it on. With Francis Ellis and Bill Walker pouring in the points, the Blue.Devils had a 10 point lead be­ fore the final gun. Francis with 21 points, and Bill with 15 ac­ counted for well over half of the Blue - Devil’s points. Coach Stanfield said is was the best game he had seen his boys play since he had been at Farmington. On Friday night of last week FHS traveled to Churchland to play their strong ball teams. The girls were again victorious in a 42 to 29 victory, but the boys had their hopes dampened In losing 32 to 41. The girls with Emma Sue Allen scoring 28 points grabbed an early lead and held it throughout the game. Churchland threatened only once. This was in the third quar­ ter, but the Blue Devils managed to fight Churchland off and rack up a 12 point lead before the game was over. The Farmington lassies with a record of 4 wins and 1 loss show signs of being as strong as last year’s championship team. The boys got off to a slow start by scoring only 3 points in the first quarter to Churchland’s 13. But in the second quarter the Blue ■Devils came back and cut the Churchland lead to 4 points. In the third and fourth quarters the Churchland five proved too much for the Blue Devils. Bill Walker led the Blue Devils in their try for a fourth straight win with' 11 •points. TURKEY SHOOT There will be a turkey shoot the Ray Sowers store in Ad­ vance on Saturday, December 19, begining at 1 p.m., sponsored by F. P. Tucker. A Crescent Motor Go. CUSTOMER Is More Than a Name On Our Records \ Each customer i.; a flesh and blood man or woman with human emotiens, personal problems, individ­ ual hopes and plans. Is More Than a Voice On the Telephone A customer's call is our signal for 'action, an opportunity to serve, cur chance to make a friend for our firm Is More Than a Signature on a Letter Each letter we receive, no matter how minor it seems, is important to the customer and merits our full attention. Is Never An Imposition On Our Time "Our time is your time" should be our atti­ tude toward every customer because that is why we are here . . . to serve. Is Not An Outsider The customer is truly an "insider" . , . our reason for existence . . . our "boss" . . . A' highly important part of our concern.. Is Not a Favor Seeker We do not confer a favor when we serve a customer . . . instead the customer does us a favor by doing business with Crescent Mo­ tor Co. Is Not Dependent on Us We depend on the customer. Without his support there would be no opportunity to serve in the field of Automotive sales and service . . . in fact there would be no need for us to exist. It Is Always a Pleasure To Serve You... A CRESCENT MOTOR CO. CUSTOMER A CRESCENT customer is a. friend whose confidence, and good will form our most price­ less assets. It is our aim to justify this confidence by serv­ ing, efficiently. HOURS; 7:30 a.m., fo 6:00 p.m. Monday thru Saturday V/< Blocks from Square on East lanes St.—l’lione 5G0 SALISBURY Cornateer PTA Mooting The regular month'v meeting of the PTA was lieJd Thursday, Dec. 10 in the school auditorium. During tho business ses ion it was voted that the P.TA go on record favoring the continuation of thfe 119 year old Farmington Post Office wihch is under considera­ tion for discontinuance. The program was in charge of the music committee, Mlns Belle Smith, Miss Betty J. Mabe and Mrs. Nell Lashley, assisted by 50 children from the grades. It was the Christmas Story, told in scripture, song and tab­ leau. Roby Frank Shore read the scripture; Gilbert Tuckor sang a solo, “Away In A Manger.” The audience joined with the group 'n sing'ng "Joy To The World,” niter whihh Rev. G. C, Graham dismissed the unusually large PTA nuc’.’.ence. Refreshments were served in the cafeteria. Miss Louise Seats, student nurse at Mcoresville Hospital, was home for the week end. Mr. nnd Mrs. Euscne James and family spent Sunday in Chapel Hill. Mr. and Mrs. Roger Moore- of i Winston - Salem were Sunday guests of Mr. and Mrs. E. C. James, , Mr. and Mrs. J. C. Barney vis­ ited his father, the past week end. • Mrs. J. C. Galloway, who has been visiting relatives here, re­ turned Friday, accompanied by her shter, Mrs. J. W. Williams, to her home in Greenville, N. C. Lt. James M. Brock- returned Tuesday to Smoky Hill Air Base, Salina, Kansas, after a 15 lay fur­ lough with his parents. Pfc. Rich­ ard Brock returned to Fort Bragg Monday after a week end pass at home. give e FURS for CHRISTMAS Natural RANCH and WILD MINK SCARFS 2 7 » Per Skin 3 and 4 Skin Arrangements u f e w / ARPEGE SCANDAL PRETEXTE RUMEUR MY SIN $2.25 to $40.00 Plus Fed. Tax • V - with an old-fashioned T R E A S U R E C H E S T prepared by If Christmas shopping is proving to be a problem . . . if there is one or. ycur list, whom you are still uncertain of pleasing . . . buy her a surprise treasure chest . . . personally selected and filled by our expert authorities. You'll find just the items to please and compliment any-age personality and at the price YOU want to pay. Listed are just a few of the many selections. JE W EL B O X Velvet tie and cuff links Christmas corsage A Silk Squares PERFUME Only 3 « 5 0 JEW EL B O X Christmas corsage 3 pair 60 gauge hose PERFUME Only 4.50 JEW EL B O X Pin and earring set Christmas corsage PERFUME Only 3 * ^ 0 GIFT WRAPPING ANOTHER CONVENIENCE OF SALISBURY, N. C. THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 17, 1953 Pino [ j Mocks Mr. and Mrs. Harmon McMahan were dinner guests of Mr. and Mrs. John Harding Sunday. Mrs. Flavc Ferebee spent a few days last week with her sister, Miss Eloise Ward. Mrs. Luther Ward visited iter daughter, Mrs. Ervin Hepler, and n o w grand-daughter,' Carolyn Ann, at Casstevens Clinic, Fri­ day. Mrs. DeWilla Smith and Mar­ lene Dull visited Mrs. Mary Smith in Mocksville Sunday afternoon. Mrs. D. W. Lowery spent a few days last week with her daugh­ ter, Mrs. F. W. Dull. Mrs. Odel James war, hostess to the Friendly Book Club Wednes­ day afternoon. Fifteen members were present. The January meet­ ing will be in the home of Mrs. G. C. Graham. Mr. and Mrs. L. S. Shelton, Jr., and son, Gene, were. Sunday din­ ner guests of Mr. and Mrs. Ves­ tal Dull. Rev. W. E. Fitzgerald filled his appointment here Sunday even­ ing. Ho spoke on the text “What Christinas Means to us in the Modern Days.” Mr. and Mrs. Cleve Allen of Fork spent Sunday with Mr. and Mrs. Joe Jones. Mr. and Mrs. Kermit Beau­ champ of Lexington spent some time here Sunday with Mrs. J. W. Beauchamp. Mrs. Earl Myers and Frank My­ ers shopped in Winston-Salem last Thursday. Mr. and Mrs. Byerly Sidden of Fork spent Sunday afternoon with Mr. and Mrs. Roy Carter. Mr. and Mrs. Robert Davis were hosts at a birthday dinner Sunday honoring their son, Donnel Gray, on his second birthday, and also, Mrs. W. L. Dixon, on her 73rd birthday. Mrs. Dixon Is the moth- ?r of Mrs. Davis. Covers were laid for 26 members of the fam ily. Oak Grove &aaaasias:2!asia>asi3:si8isiasisiasi»i3!3i9i3i»sisisi9i3i2i3isiasisi3iasiaaasia»i NOTICE! FOR YOUR SHOPPING CONVENINCE We will be each evening open ’til 9 Mr .and Mrs. Floyd Smith and children of China Grove were Sunday visitors of Mr. and Mrs. W. L. Mullis. Earnest Mullis of Hickory vis­ ited his brother, W. L. Mullis, Saturday. The Irvin family had their reunion at the community build­ ing Sunday. It was also Mrs. Ir­ vin’s birthday occasion. In observance of Universal Bible Sunday, a collection was taken at the church for the Amer­ ican Bible Society.. Mrs .Forrest Whitaker has been very ill but is improved. The many friends of Mrs. R. L. Whitaker, Jr., will be sorry to know she has been very ill again. The W. S. C. S. held its De­ cember meeting at the community hut Saturday night with 15 mem­ bers'and one visitor present. The topic of the program that was presented was "Gracious Gifts Are Given." Gifts were brought to be given to elderly people, at ! the county home. At the conclu­ sion of the meeting refreshments were served by Mesdames Pansy Koontz and Mary Leonard and Miss Dora Leonard. The January meeting will be held at the home of Mrs. Gilbert Atwood./ The Ladies Class of Oak Grove church are having their Christmas party Saturday night, Dec. 19, at the home of the teacher, Mrs. Boger, Route 3. FROM NOW UNTIL CHRISTMAS y y VI ya y y y y y y y y s? » y y y v § 5#t£tgtgtetgtetetsisi£te'eK;tetgts‘ets‘g‘S!g‘ete!gtei€‘si€i€‘stztsi5ig!Gie!sigigigit;ietg>gig!gisisi<; Hendricks & Merrell Furniture Company Elbaville Phone 342 Mocksville, N. C. Mr. and Mrs, Bill Ellis and children shopped in' Salisbury Saturday. Mrs. Chas, W. Hall and Mrs. Clara Hartman shopped in Win­ ston-Salem Friday. Mr. and Mrs. Buck Edwards and baby of Greensboro and Mr. and Mrs. Johnny Dunn and Mitzi of Winston-Salem were Sunday dinner guest of their parents, Mr. and Mrs. Sain Hege. Mrs. C. M. Markland was hon­ ored .with a surprise birthday party Tuesday by her family. The event being her 50th birthday. Mr. and Mrs. Bill Hartman of Winston - Salem, Mr. and Mrs. George Hartman and children, wtr ^ Make Them Happy with Gifts From Hall Drug Co. HERE YOU CAN FIND AN ABUNDANCE OF GIFTS AT PRICES TO FIT YOUR BUDGET ; . . FOR YOUR ENTIRE CHRISTMAS LIST. • PEN & PENCIL SETS • MEN’S PIPES • BOX STATIONERY • COMB & BRUSH SETS • NECKLACE SETS in lovely rayon lined boxes • TOILET GOODS SETS • PERFUME in dainty boxes 9*Give Chocolates tg>g>z<e'e>S!eie«s‘<:ie*e>sie!e'c>c'c>e<e'c|0£|etc'3'eic|s'<ie|ste|c'e,c'e|e's|&1c|c'e|3|eie|c|*tcteie>etelcte'elc'c'( !S 3K % a |WE HAVE WHITMAN’S AND HOLLINGSWORTH J KIN PRETTY GIFT BOXES ' |£K Hall Drug Company Phone 141 Mocksville, N. C. ----—WE GIVE S & II GREEN STAMPS------ and Mr. and Mrs. Chick Hartman of Redland wore Sunday visitors of Mrs. Clara Hartman. Mr. and Mrs. Lindsay Petree and daughter, Dianne, of Winston- Salem were Sunday visitors of Mrs. Charles W. Hall. A large group of Advance-El- baville club members attended a Christmas party at Bailey’s Chapel club Wednesday. Robn Ellis spent Friday night and Saturday with Charles Mark- 1 land, Jr. . ■ BIRTHS ANNOUNCEMENTS Mr. and Mrs. John N. McDan­ iel, Route 1, announce the birth of a daughter, Sonya Diane, on December 12, at the Rowan Me­ morial hospital in Salisbury. Mr .and Mrs. Leroy Dyson, Har­ mony, Rt. 1, announce the birth of a daughter, Mary Ann, on Dec. 13, at Rowan Memorial Hospital, Salisbury. IT PAYS TO ADVERTISE T O T S to T E E N S beautiful gift^ of robes for tH8t very spgfiial toy I delight the little gen­ tleman with a robe copied from Dad's. •® ORLONS • CORDUROYS • FLANNEL Sizes 3 to 12 2 - 9 8 to 8 -9 5 •V •’» ' iAlways a Large Selection to Choose From n ** Guyes Tots to Teens TELEVISION PROGRAMS PHILCO TELEVISION -Sales and Service— Hendricks - Merrell Furniture Company Salisbury St. - Mocksville JEWELRY ANDEXPERT WATCH REPAIRING ----------•----------- FOSTER’S WATCH SHOP “OUTFITTERStoMEN” ----------»----------- TREXLER BROS., Inc. SALISBURY, N. C. ManufacturersofLadies’s Pajamas — _ #----------- MONLEIGH GARMENT CO. 9:00- 9:15 0:45lo:oo 11:3012:0012:1512:^0 12:451:302:00 2:302:00 3:30 4:004:00 4:30 5:005:00 5:15 5:155.30 0:00 6:15 6:30 0:45 7:00 7:15 7:30 7:45 8:00 8:30 9:00 9:30 10:00 10:30 11:0011:10 11:1512:30 9:00 9-15 9:4510:00 10:3011:0011:3012:00 12:1512:3012:451:302:00 2:303:00 3:304-00 4:30* 5:00 5:155:30 0:00 6:15 0:30 0:45 7:00 W SJS W INSTON-SALEM CHANNEL 12 THURSDAY t 3— I'll B uy That U— JVlornmtf Show 3—G uiding Light 3—A rthur G odfrey 3— Strike It Rich 3— Valiant Lady 3—L ove OS L ife 3—Search F or T om orrow 3—Carolina C ookery 3— G arry M oore 3— Betty Feezer Show 3— A rt Liukletter ^3—Nancy> Carter Show 12— Kate Sm ith 3— B ob Crosby 3—A rthur Sm ith 12— W elcom e Travelers 3— 12— On Y our A ccount 3— Cartoon Carnival 12— A tom Squad 3— G abby H ayes 3— Story Painter 3— L one Ranger 12— H ow d y D oody 3— Shop b y T V 12— Roundup T im e 3—Jane From an 3— Esso R eporter 3— W eather R eport 3—Johnny's H obby House 12— Johnny Com as Presents 3—Spin T o Win 3— D ouglas Edwards 12—Curt L. Rogers Show 3— Spin T o Win 12—Cam el N ew s Caravan 3— B oston Blackte 12— G roucho M arx 3— I Lend T hree Lives, 12—T -M en In A ction 3— L ux Theatre 12—Dragnet 3—B ig T ow n 12—Ford Theatre 3— M eet M r. M cN utley 12— M artin K ane 3— P lace T he Face 12—N ew s Final—sign o ff 3—N ew s and Sports 3— W eather 3— Late Show 3—S ign -off FRIDAY 3—Christopher Show 3—M orning Show 3—G uiding Light 3—Jack P arr Show 3— Man A round The House 3—M an A round T he House 3—Strike It Rich 3—Valiant Lady 3—L ove o f L ife 3— Search F or T om orrow 3— Carolina C ookery 3—G orv M oore 3— D ouble or Nothing 3—A rt Linkletter 3—Big P ay off 12—K ate Sm ith 12—K ate Sm ith 3—B ob Crosby 3— M ovie M atinee 12—W elcom e Travelers 3— 12— On Y ou r A ccount 3—Junior R ancho 12—A tom Sound 12—G abby Hayes 3—Hopalontt Cassidy 12—H ow dy D oody 3—F ootball This W eek 12—Roundun T im e 3—Coke T im e 3—Esso Reporter 3—W eatherm an 12—N ew s and w eather 3—A n yb ody's Guess 12—Johnny Com as Presents W BTV CHARLOTTE CHANNEL 3 7:15 3—D o It Y ourself 7:30 3— D ouglas Edwards 12—Eddie Fisher 7:45 3— P erry C om o12— Cam el N ew s Caravan 8:00 3— M am a 12— G arrow ay A t Large 8-30 3—T opp er . 12—L ife of R iley 9:00 3— P layhouse of Stars 9:30 M irror Theatre 12— Boston Blackie 10:00 3— N ational Theatre 12—B oxin g 10:30 3— P ride o f T he Fam ily 10:45 12— N ew s Final (Sign off) 11:00 3— N ew s A nd Sports 11:10 3—W eather R eport 11:15 3—Late Show 12:30 3—S ig n o il SATURDAY 9:30 3— Captain V ideo 10:00 3— Captain M idnight 10:30 3— Johnny Jupiter 11:00 3—C isco K id 11:30 3—Sm iling Ed M cC onnell 12:00 3—B ig T op 1:00 3— W estern Feature 2:00 3— Big Picture 2-30 3—Talent Patrol 3:00 3—P ro Basketball 5:00 12— Sagebrush Theatre 5:00 3— Judge For Y ourself 12— Film Feature G:Q0 3— Ram ar o f the Jungle 6:30 3—Fireside Theatre 12—This is The L ife 7:00 3— Burns and A llen 7:00 12—PJtdmont P layhouse - 7;30 3— Beat The C lock12—A rm chair Playhouse 6:00 3—Jackie G leason 8:30 12— A m ateur H our 9:00 3— F oreign Intrigue 9:00 12—Excursion 12— Show o f Show s 10:00 3—F ord Theatre 10:30 3—F our Star P layhouse 12—Hit Parade U:00 3— W eeks N ew s In R eview 12—N ew s Final (Sign O ff) 11:15 3—W restling SUNDAY 12:00 3—This Is T he L ife 12:30 3—Nam es The Sam e 1:00 3— Stu Erwin 1:30 3— Frontiers o t Faith 2:00 3— Redskins F ootball Gam e 12—P rofessional F ootball 4:30 3— A dventure • 12—F ilm Feature 5:00 3—O m nibus 5:00 12—Triangle Theatre 5:30 12—Y outh W ants T o K now 6:00 12—Sunday Vespers 6:30 3— H arriet and Ozzie 12—K ukla. Fran and O llie 7:00 3— L ife W ith Father12— W inchell and M ahoney 7:30 3—Jack Benny 12—M r. Peepers 8:00 3— 12—C om edy H our 9:00 3—Fred W aring 12—T V Playhouse 9:30 3—M an Behind T he Badge 10:00 3— W ho Said That 12—L etter T o Loretta 10:30 3— W hat’s M y Line12—M an Against Crim e 11:00 3—Sunday N ew s Special 12—N ew s Final S ign -off 11:15 3—Toast o f T he T ow n >2:15 3—Sign off General Electric —Sales and Service— DANIEL Furniture & Electric Company AX OVERHEAD BRIDGE MOCKSVILLE, N. C. Laundry and Expert Dry Cleaning. Mocksville Laundry & Dry Cleaners DEPOT STREET TELE - KING TELEVISION -Sales and Service— C. J. ANGELL APPLIANCE CO. MOCKSVILLE, N. C. R. C. A. WESTINGHOUSE-Sales and Service— DAVIE FURNITURE CO. THURSDAY, DECEMBER 17, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE PAGE SEVEN C L A S S IF IE D A D R A T E S : T W O C E N T S P E R W O R D P E R IN ­ S E R T IO N . M IN IM U M C H A R G E 5 0 C . C A S H W IT H O R D E R . C A R D OF* T H A N K S $ 1 .0 0 , C A S H W IT H O R D E R . W O M EN W AN TED — H ousew ives nddrcss Advertising post cards. M ust have good handw riting. L I N D O , W nlcrtow n, Mnss, 12 17 4tp P E N N SY L V A N IA AN TIQ U ES—091 South M nin, L exington, N. C. Christm ns dis­ play in store, furnished npartm cnt nnd house. Special Sale until Christmns. 10 to 10 every w eekday. K ELLERS. 12 17 U p F O R SALE— pair o f good m ules, S and 8 years old. One 11 year old m are, one M cC orm ick - D eering riding culti­ vator ,and other farm ing tools. A bar­ gain to quick buyer. See G . F. Forrest, A dvance, Rt. 1. 12 17 2tp F O R SALE— P ractically new gray break­ fast room suite. .A lso good 1946 M er­ cury, with good radio and good hent- cr. Cnn be financed; W oth $600. Priced $500. See Frank Lnird. 12 17 ltp FO R SALE— 7 acres land, Farm ington T ow nship, \% m ile south K ing's Store. B est offer. A lvis Laird. 12 10 2tp Record consumer incomes con- tinue to support a strong United States demand for food. . NOW . . . you eon ga' TWO (regular $2.95 cach) VENIDA "Hang Over" Hangers, designed to conform to your everyday dressing habits—coat first then trauscn— for the price of ONE . . . PLUS a BONUS GIFT of o sturdy pair of convas sole, terry cloth slippertl These beautiful hongers ore made of durable cellulose plastic with an attractive walnut finish—an unusual lift* time convenience for men ond women! Individually pock* pged In a colorful picture box—an Ideal gift! V E N ID A MAKERS OF FAMOUS VENIDA HAIR NETS Venida Products 119 West 40th St.. New York IB, N. Y. • ----------------------------------------------- Enclosed Is my check or money order for $2.95. Send me the 2 Vonfda "Hang Over" Honffer* PIUS your Specie) Bonus CJft of 1 Poir of Terry Cloth Slippers. Check Slipper Siie Q (Small) □ (Medium) □ (Lorsje) NAME__________________________________________________________________________________ ADDRESS______________________________________________________________________________ -CITY— - ■ , ■ TONE- - STATE____________|____________ PrAN O S—W e have the piano you have been look ing for. Prices begin at $79. Sm all deposit w ill hold any piano for Chrism as delivery. Start paym ents n ex t year. T erm s to suit you. K LU T TZ M U SIC CO M PAN Y, G ranite Q uarry, N. C. 12 3 3tp IF YO U A R E HON EST A N D A R E NO T SATISFIED w ith present jo b see Paul A n gell on Route 4. Y ou can live in D avie, Iredell or R ow an County.12 10 2tp F O R RENT— A house on R oute 4. Sec P aul A ngell on Rt. 4, 10 10 2tp F O R SALE— T w o lots, W . A . Blake prop­ erty. One lot 5.7 acres, another 10.9 acres fronting the B ixb y, F ork hard surface road. See or call B. C. B RO CK , office tel. 151. 12 10 2t« LO ST— on e saxnphone, E -Flat A lto. H ol­ ton m ake, cilver, factory serial num - ' b er 11275. In black carrying case bear­ ing w ords "C ataw ba C ollege. Salis­ bury. N. C ." A ccessories included. Left In car w hile receivin g a ride from Ca­ taw ba C ollege to D avie Crossroads. N o­ tify D avid E, M ilholen nt N o. 4 C ircle D rive, C ooleem ee, or Cataw ba C ollege, Salisbury, N. C. 12 3 2tp W AN TED — H ave yo'*r prescriptions filled at H A L L D IW G CO M PAN Y. Phone 141, M ocksville. *tfn G EN E RAL ELECTRICAL CO N TRACTIN G and E lectrical Service. N. C.^ Licensed Electrician and Contractor. R E A CER­ TIFIED CO N TRA CTO R A N D D E A L ­ER. RO D W ELL ELECTRIC COM ­ P A N Y , M ocksville, N . C. tfn E X E C U TR IX NOTICE N otice is hereby given that M ary Lclia H opkins has this day qualified as ex ec­utrix of the 'L ast W ill and Testam ent o f A lice M artin H opkins, deceased, la t e ; o f the C ounty o f D avie and State o f N orth Carolina. A ll persons h a v in g ! claim s against said estate w ill present ' tem . du ly verified, to M ary L clia H op­kins, at her hom e on M ocksville. Route 3, cm or before the 26th day o f N ovem ­ ber, 1954, or this notice w ill be pleaded in bar o f their recovery. A ll persons in­ debted to said estate w ill please m ake im m ediate settlem ent. 11 26 6tp T his the 19th day o f N ovem ber, 1953. M A R Y LELIA H O PK IN S, executrix o f A L IC E M A R T IN H O PK IN S, deceased. EX E C U TR IX NOTICE N otice is hereby given that F lorence S. Leonard has this day qualified as ex ecu trix o f the Last W ill and Testa­ m ent of W . A . Leonard, deceased, late o f the County o f D avie nnd State of N orth Carolina. A ll persons having claim s against said estate w ill present them , du ly verified, to Florence S, Leonard, at h er hom e in A dvance, N. C., on or before D ecem ber 10. 1954, or this notice w ill be pleaded in bar o f their recovery. A ll persons indebted to said estate w ill please make; im m ediate settlem ent. TM « thn p.?rd day o f O ctober, 1053. FLORENCE S. LEO N AR D . E xecutrix of W . A . Leonnrd, deceased. 12 10 Gt AD M IN ISTRATO R'S NOTICE North Carolina—D avie County T he undersigned, having qualified as adm inistrator o f the estate o f J. B. C ook, deceased, late o f D avie County, this is to n otify all persons having claim s against said estate to present them to . thi» undersigned on or before the 4th day o f D ecem ber, 1954, or this notice w ill he pleaded in bar of their recovery. A ll persons indebted to said estate w iii please m ade im m ediate paym ent to the undersigned. 12 3 Ctn T his the 1st day of D eem bcr, 1953. W . B. REN EG AR, A dm inistrator R . B. SAN FO RD , Jr., Attorney. Announcement Please do riot bring in any more beef until after Jan. 1st. We have all we can handle between now and that time. We will close Dec. 24, 25 and 26, for the Christmas holidays. However, we do have space for hogs, so bring in your hog meat, we can handle it right now. Only two more days for dressing chickens—Dec. 10 and Dec. 17. We wish to thank all our friends and customers for their cooperation and for their business. We sincerely appreciate it. Davie Freezer Locker Arthritis? I have been wonderfully bless­ed in being restored to active life after being crippled in nearly every joint in my body and with muscular soreness from head to foot. I had Rheumatoid Arthritis: and other forms of Rheumatism,' hands deformed and my ankles were set. j Limited space prohibits tellinB you more here but if you will write me I will reply at once and tell you how I received this won­ derful relief.MRS. LELA S. WIER 2805 Arbor Hills Drive P. O. Box 2695 Jackson 7, Mississippi IT PAYS TO ADVERTISE _ . . . . . OISCOMFO* P « r Bottle Electric Giving For Better Living Get your last-minute shopping wropped up with one elcctrify.'ng shopping tour . , . give the gift that keeps on giving! See Your Electric Appliance Dealer D U K fy POWER COMPANY t w n g . / ije d n & n t (@ z to & n a < L W H E E LS A L IG N E D By the BEAR System For Safe DrivingROBIE NASH 1819 S. Main St. Phone 650 | SALISBURY, N. C. A Three Days' Cough Is Yo^r Danger Signal Crcomulsion relieves promptly because' it goes into the bronchial system to help loosen and expel germ laden phlegm and aid nature to soothe and heal raw, tender, inflamed bronchial membranes. Guaranteed to please you or money refunded. Crcomulsion has stood the test of millions of users. CREOMUI?SION relieves Coughs, Chest Coldi, Acute Bronchitis m m fc imiTgMiiftMi egy< . . . TAYLOR MATTRES­ SES are so soft and com­ fortable! Every bed should have one of these QUALITY MATTRESSES. T h e TAYLOR MAT­ TRESS COMPANY In­ vites you to come in and see the most popular MATTRESS . . . TAYLOR MATTRESSES. When you want the best for less in sleeping comfort buy a TAYLOR MATTRESS. See your local FURNITURE dealer for information on TAYLOR MATTRESSES.- « Taylor Mattress Co. SALISBURY, N. C. ROWAN PRINTING CO. Hhonfc 532 - Salisbury, N C One ot the largest printing and office supply houoo* in the Carolina.'. • Printing • Lithographing • Typewriters • Complete Office Supplies HAVE YOU THE ARTHRITIS MISERY? h e r e ’s w o n d e r f u l n e w s ! Hospital tests prove Musterole gives high­speed long-lasting relief from pains of arthritis misery. Also greater ease in moving. Highly medicated. Concentrated. You can f e e l it work to bring fast relief! MUSTEROLE SHOAF COAL AND SAND COMPANY Depot St. Phone 194 H I M * » « » • „mtseniPTioH * jfexalE , DRUG STORE AUTOMOBILE SAFETYGlass & Mirrors Installed —All Models—ROBIE NASH 1819 S. Main St. — Phone 650 Salisbury, N. C. W ilk in s M ru y C o . fbone ‘41 S H 0 A F COAL, SAND & STONE — Prompt Delivery — Phone 194 Use An Enterprise Want Ad l CUSTOMBUILT Venetian Blinds - Aluminum Frame Screens - Aluminum Awnings • Ornamental IronSalisbury Venetian Blind Manufacturing Co. Statesville Road Phone 4319 Salisbury, N. C. For Dogs and Livestock SEVERE MANGE, ITCH, FUNGI, BARE SPOTS AND MOIST ECZE­ MA (puffed, aaoitt c m and feet). Ear aoreness, ear mites, puts pim­ ple* and other >lcio >rrit»ciont. Pro­ motes healing and hair growth ot YOUR MONEY BACK. M A & ■ / 'o l •• •• youn, dag -uKru&t WILKINS DRUG CO. PHONE 21 MOCKSVILLE IT PAYS TO ADVERTISE Authorized Cadillac - Studebaker Service Performed by Factory-Trained Mechanics ,3EUABLE -t/ilHECKING /K|j|WtfSTING V S e w u r in © Baked EnamelAUTO PAINT1 G All Type BODY WORK Drive IM Soon For That Fall and Winter Check-Up 24-Hour Wrecker Service Day Phone 14 — Night Phone 720 ® Hedrick Auto Co., Inc. Your Cadillac and Studebaker Dealer PHONE 14 120-122 N. Church St. Salisbury, N. C W W W A W W A V M V M V A W / A V A V b W W W W W D I R E C T O R Y o f D e p e n d a b l e B u s i n e s s a n d P r o f e s s i o n a l S e r v i c e DRUGS DRUGS DRUGS The Best in Drugs and Drug Service. Prescriptions Accurately Compounded Drag Co. Phone 141 Mocksville STATIONERY AND JOB PRINTING WHATEVER YOUR PRINTING NEEDS—WE CAN DO THE “JOB” TO YOUR COMPLETE SATISFAC­ TION. We Represent LEE SOUTHERN ENGRAVEtiS THE MOCKSVILLE ENTERPRISE Flour, Meal, Feed Stuff and Grain Miiiiifg Co. Phone 32 Near Depot Mocksville O Pure Crystal Ice O Coal for Grates, Stoves Furnaces and Stokers Ice & Fuel Co. Phone 116 # Chrysler - Plymouth SALES & SERVICE # In tern atio n a] T ru c k s Davie Motor Company Phone 169 M ocksville I WHArS YOUR PR08LF.M? ) ----------7/------------------------ The business firms listed in this directory can be depended upon to solve any problem in their field. No matter what your problem might be — you may find the answer here. H e l p F ig h t T B B u y C h r i s t m a s S e a ls . Q U A L I T Y DRY CLEANING & LAUNDRY MOCKSVILLE L A UN DRY PHONE 190 THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 17, 1953 Turrentine Mrs. Thom as Nance and chil­ dren o f Cornatzer spent Saturday with her parents, Mr. and Mrs. E. C, Lagle. Ann Forest spent Sunday with Jo A nn Long. M r .and Mrs. Jack Carter of M oorcsville visited Mr. and Mrs. L. F. W agoner Sunday. Mrs. Harold James and chil­ dren, Mr. and Mrs. Clarence A lex ­ ander, Mr. and Mrs. R. Z. W ag­ oner w ere Sunday guests o f Mr. and Mrs. J. T. Alexander. Pfc. B obby Lookabill and Mrs. Ned Lookabill of M ocksville vis­ ited Mr. and Mrs. Carl Jam es and Pfc. Charles Janies Saturday night. Tho W . M . U. of Turrentine will hold their Decem ber m eet­ ing Thursday night at the hom e of Rev. and Mrs. E. . Eagle. M r. and Mrs. Hubert Carter and A nn w ill leave this w eek for Texas to spend the Christmas holidays w ith their son, A 3c Jim m y Carter,' Mrs. Carter and baby. Mr. and Mrs. D ew ey Everhardt of M ooresville w ere Sunday visit­ ors o f M r .and Mrs. Ransom Cook. Advance fc»Sl»»lMWl»»iaiSia!aiSlSiai3l3t»3lSl»iaiSl»i3iai:J)SiaiSl8iaiai9lSlSl»Siaiai3l»S!*lSl9iS« T U ,G t f » -GIFTS GALOR E ------— Bill Fo ld s.............................. .....$2 to $15.00 Sets Old Spice —- Yardley— - Max Factor Seaforth for M en .........................$1.50 to $4.95 Kidmetics for the 4 to 14 Set Argus and Eastman C A M ER A S and Gift S e ts................... $5.00 to $25.00 Electric Blankets, a nice gift ...................$19.95 E L E C T R IC RA ZO RS: Scick — Remington— Sunbeam. ------Ask for our Gifts Galore Catalogue.------ See our Christmas Merchandise Wilkins Drug Co., Inc. T H E R E X A L L STO B E Phones 21 & 400 Mocksville, N. C. § »<* SiM w w w M W w icicietM flM iw tw iw w w M W W W W W M M iW fw tteit M r. and Mrs. C. D. Peeler of Salisbury, visited Mr. and Mrs. W ill H endrix, Sunday. Mrs. Grace Sprye and M ildred Sprye spcnt'Saturday in W inston- Salem shopping. Mrs. Anderson potts and Mrs. Ro~.e H endrix m ade a business trip to M ocksville Sunday. ‘ M r .and Mrs. Garland Sprye, M ildred Sprye, Troy MeElrath, B ob Sprye and Virginia Berrier visited friends in South Carolina Sunday. M rs. W . E. Fitzgerald is spend­ ing a few days in Durham with Mr. Fitzgerald’s m other, w ho is a patient in the hospital there. W ill H endrix is im proving af­ ter being ill, it was learned. Mrs. A lice Potts is sick. Mr. and Mrs. M ajor Beaucham p .visited M r. and Mrs. Ed V ogler Sunday. Mrs. W. A. H endrix visited her daughter, Mrs. Dave R edw ine in Lexington one day lart week. • Concord Rev. and Mrs. B. C. Adam s are the proud parents of a baby boy. M r. and Mrs. Bud Foster and Ann of Cooleem ee, Mr. and Mrs. Everette Seam on and sons of T ur­ rentine, and Mr. and Mrs. John W alker and sons of M ocksville, visited Mr. and Mrs. S. D. Daniel Sunday. ■ The Hom e Dem onstration Club w ill have their Christmas party Friday at 2:30 at the hom e of Mrs. Frank Crotts with Mrs. Bill Spry co-hostess. Everyone w ill exchange gifts. ' , ' The C o-w orkers Class w ill m eet at the hom e of Mrs. Lester D w ig­ gins Saturday night at 7 o'clock. Mrs. J. D. H odges and Mrs. Carrie T utterow are sick. Jake Tutterow and daughters visited his m other, M rs.' Carrie Tutterow, Sunday. Mrs. V. A. Sw icegood and Joe shopped in Salisbury Saturday. G eorge R Boger, SH3, is visit­ ing his w ife at their hom e on Rt. 3, and also his m other, Mrs. M ary Boger. Pre-Christmas Sale .. V la h o g a n y T a b le s \our Choice Any Table Pictured For Only .95 Buy N ow fo r C h ristm a s D elivery ★ P**# Efliy P?rklng to Rftif flf W Comparable with Values to 29.50 Because they ore "M ersm an" Tables •he will be pleased beyond words . . . So ploce your order now. Take your cholc* of any on* or several styles while our present stock lasts. Cocktail, It*p, r t End Tobies all Jj e«aui£f Mqhoflqny. •' There's so Many Ways of Saying . . . but GIFTS for the from NORMAN'S say it BEST Be a "G o o d S a n ta " give her one of NORMAN'S Foam Rubber Cushioned SOFAS Your errtire Family will en­ joy the Luxury and Beauty of these Sofas with 5-inch all Foam Rubber Cushions. You Can Buy Now at New Low Prices! 1 3 9 95 W ashable Fabric B oudoir C h airs Modern Blonde B edroom Suite For Only ‘99.90 ‘29-75 5-Piece C ard T a b le S et W e hove a lovely selection of colors an^. styles in beautiful . < n chairs designed especially for p./iyour bedroom. An outstanding value in Limed Oak. Consists of Bookcase Bed, Double Dresser and Landscape Mirror. A wonderful Christmas gift. ‘19-95 The ideal gift that the whole- family will enjoy . . Your choice- of several patterns. Group in­ cludes Table and 4 Chairs. Smart P ull-U p C h airs 0n,y $ 19-95 What a lovely gift for M other. . . m she'll love the stay it wil.l dress up the living room.’ Genuine Plate G lass M irrors From $ g 9 5 Your choice of so many smart styles . . . each will be appre­ ciated the whole year through. Decorator Styled T a b le L am ps ' *6.95 Up Select a handsome' Lamp from our outstanding collection. ^ C on v ertib le S ofa -B ed s * From $ £ 9 . 9 5 Big, comfortable Sofa-Beds that quickly and easily convert into ♦ double bed. A wonderful choice of covers. * Buy Now on Easiest Budget Terms! K n eeh ole D esks From ‘49-95 Choose from lovely modem or period designs. Select now for Christmas delivery. Kroehlcr S e cticn o l S ofa s From *219.50 Everybody will enjoy this gift, your family, your friends, every­ body. Two pieces that comfort­ ably seat four people 'The Home O f G ood Furniture" ST. k n vH t t i l S A LIS B U R Y , N. C. VOLUME XXXVI • All The County News For Everybody” MOCKSVILLE, N. C., TUESDAY, DECEMBER 22, 1953 'vn r'v r"‘,ntv %*wsl *'01 Everybody”No. 44 THE NEW JERUSALEM FIRE TRU CK Jerusalem Receives New and Fully Equipped Fire Truck Truck Is Stationed As Greasy Corner D elivery wa". m ade last w eek on the new fire truck for the Jerusalem Volunteer Fire Depart­ m ent. It is a tw o-ton Chevrolet truck and was purchased through Pennington Chevrolet Com pany o f M ocksville. The truck is com pletely equipp­ ed with fire exiingushers and. all other types of fire fighting equipm ent. It carries a 750 gall­ on tank of water. The fire fighting staff is or­ ganized from th e . businesses around G reasy Corner w here the truck is stationed. J. W . Ever- hardt Is fire chief; and M ilton Taylor, O. C. Ram beau, A lfred C oble and Paul Snyder serve, as firem en. M em bership in the Jerusalem V oluntere Fire Departm ent or­ ganization is open to every resi­ dent o f Jerusalem Townsh'ipt' The paym ent of the $10 m em bership fee Entitles full protection and service of this rural fire depart­ m ent for one year. Tn case the service of the fire departm ent is needed, an alarm m ay be turned in by teiephqning Ram beau’s Service Station or Everhardt’s .Garage, or M . L. T aylor's residence, at Greasy Corner. The organization of this fire de­ partm ent was first started last Spring. Funds w ere raised through contributions and the m em ber­ ship fees. W ork is almost com ­ pleted on the new fire house w hich w ill house the truck. Tid-Bits B y GORDON TOM LINSON M ocksville has t,\vo bird lovers, and being neighbors only serves to m ake matters m ore confusing. One day recently Jason Branch w as out in his yard. Hearing a .bird off in the- distance, Mr Branch started m ocking it. (Continued on Pngc 12) Farmington Lodge Plans St. John Dinner Farm ington Lodge of A ncient Free and Accepted Masons w ill bo;d their anual St. John’s D ay, Dinner on Dec. 29, 7 o’clock, in the Farm ington High school! The. address for the annual m eeting w ill be given by Rev. E. M. Avett, Grand Chaplain of M a­ sons of North Carolina. N ew officers for the current | year w ill be presented, and also a num ber of invited guests. W i­ dows of deceased m em bers of the Farm ington Lodge w ill also be guests at the dinner.1' iCaterers for the m eal w ill be the w om en of W esley Chapel M ethodist Church. Tax Listers For Davie Tax listers for D avie County have been appointed and w ill be­ gin their w ork on January 4, ac­ cording to Mrs. Eloise Stephens,, county tax supervisor. A ll real estate and personal property must be listed by the taxpayer before a date to be an­ nounced ' later, Mrs. Stephens said. Each taxpayer must list w ith the tax lister o f his township. L o­ cations w ill be announced later. A penalty w ill be im posed on those w ho fail to list during the listing period. Tow nship listers ae as follow s: Calahaln, T. A. Vanzant. Clarksville, L. S. Driver. Farmington, M r s .. M aurine W ard. Fulton, Miss Lucille W illiam s. Jerusalem, * Mrs. Margaret Saunders. M ocksville, Mrs. MeOtis Ever­ ette. Shady G rove, Mrs. A lice Potts. Mrs. Tom M eroney w ill list taxes for the Tow n of M ocksville. P e r s o n a l Greetings In addition to thc regular advertisem ents and new s items in this issue, you w ill find many Christmas features. Tlierc arc personal m essages for a M erry Christmas from the various business firm s o f this area. In t'pprcciation for your patronage and friendship, they arc extend­ ing to cach of you the best w ish­ es of the holiday season. There w ill be no publication of tliis new spaper next week. As has been our custom , w c suspend publication for this w eek in order that the staff of this new spaper m ay en joy 'th e Cliristmas holidays w ith fam ily and friends. W e take this opportunity to extend to each o f you the w arm ­ est greetings for a M erry Christ­ m as and a Happy N ew Ypar. Draft Board Reclassifies The D avie County B oard o f Se­ lective Service m et Thursday evening and review ed classifica­ tion of Davie County registrants. T w elve registrants w ere placed into 1-A from a form er classifi cation of 2-C (farm ing). Names and addresses of those placed in 1-A are as follow s: B illy Gene A llen, Rt. 3, M ocks­ ville. J. N. Bow den, Jr., Rt. 1, A d vance. Law rence W alker' Cartner, Rt. 1, M ocksville: V erious Barnes A ngell, Rt. 2, M ocksville. ' Odell A lfred B oger, Rt. 2, M ocksville. John Carl Phelps, A dvance, Rt. 1. ■ ■ B urley E dw in B oger, Rt. 2, M ocksville. Charles Seabon Cornatzer, Rt. 1, Advance. W illiam G lenn B oger, Rt. 1, M ocksville. Jerry Nelson Y oung, Rt. 1, A d­ vance. Reginald Jackson Seaford, A d ­ vance, Rt. 2. Clyde H enry- ■ B oger, Rt. 3, M ocksville. Other changes in classifica­ tion m ade by the board were: one into 1-C (enlisted); one into 5-A (over age); seven in 2-C (farm in g); one into 1-C (reserve); one into 1-C (discharge); four into 1-C (inducted). • M em bers of the D avie County Board o f Selectice Service in­ clude M iles A. Carpenter, chair­ m an; C. A. M cAllister and Dr. W. M. Long, m em bers. Mrs. Em ily Cartm ell is secretary to the board. D a v i e C o u n t y P la n s F o r A V e r y I S l o t n ? i o ( 3 o £ T I I CHILDREN AN D SA N TA CLAUS is one story o ’ Christmas in Davie County and throughout the W orld. Little Barbara Lash, age six, daughter of Mr. and Mrs. Shulie Lash of M ocksville holds her present and looks at Rita Daniel, daughter of Mr. and Mrs. R. W . Daniel of M ocksville, w ho is sitting on Santa’s knee adm iring her doll. Dan ton Sain, six-year-old son o f Mr. and Mrs, J, D. Sain, M ocksville, Route ,4 leaves no doubt as to his present as he brandishes a "six-shooter." Heritage Holds Christmas Party The Heritage Furniture Com ­ pany concluded w ork activities last Friday afternoon with their annual Christmas Party. H eritage President, E. S. W ood, addressed the em ployees express­ ing appreciation on behalf of the com pany for their loyalty and pledging efforts on the part of the m anagem ent for the best possible year during 1954.- C. C. Hartman, Personnel M an­ ager, wsnchgaira ager, was in charge of the pro­ gram. Em ployees w ho had been with the com pany for live years were persented with pins. A drawing was held with Christmas presents being awarded the lucky ones. “ Panhandle P ete" fre'h from a brief appearance with Arthur G odfrey, presented entertainm ent with his one-m an hand appara­ tus, follow ing which barbccue was served to the group. A t the conclusion of the program all of the em ployees w ere given a bag of treats. ' - Jaycees Hold Christms Party The Mocksville. Junior Cham ­ ber of Com m erce was host Thurs­ day night to aproxim ately sixty chi'dren of Davie County, age- ranging from six to twelve. Each individual Jaycee escort­ ed his guests to and from the an­ nual Christmas Party held at the Rotary Hut. Paul Richards was in charge of the program . . A fter playing a num ber of games and participating in var­ ious contests, the children w ere shown m ovies, Ice cream and cookies w ere served, Sarita Claus then paid a v isit‘and distributed special gifts and a bag of treats to all the children. Construction Bids Total $103,314 for Cooleemee Union Gives Children's , , Christmas Party Local 251, United Textile W ork­ ers o f A m erica, AFL, at C oolee­ mee, gave their annual Christmas party for children 12 years of age and under at the Cooleem ee School auditorium on Saturday m orning. Each child attending receive da bag consisting of fruits, nuts, candie and a toy. Rev. J. W. Klein o f the C ool­ eem ee Baptist Church presented tho Christmas program . Harold 'F oster Business Agent of the Union, said that approxi­ m ately 800 children attended. Tobacco Meeting To Ee Held Jan. 5 A m eeting of interest to every tobacco grow er will be held in the Court house in M ocksville on Tuesday night, Jan. 5, at 7:30 p. tn. Harold Nau, Extension T obac- " o Specialist, will be here to con­ duct this meeting. Recom m ended varieties, plant bod practices, nem atode control snd n'.l phase-, o f tobacco produc­ tion w ill be discussed. The latest Information from the tobacco ex­ perim ent stations w ill be brought out. Every tobacco grow er in the county is invited to this m eet­ ing. YULE PA R T Y A Christmas party w ill be giv­ en W ednesday at 2 p,m, in the F ejlow -hip Hall o f the First M ethodist Church for the Prim ary Departm ent of the Sunday school. A ll children in the departm ent are urged to attend. Contracts To Ee Awarded On Dec. 28 L ow bids totaling $103,314 were opened here last Thursday by the Davie County Board of C om m i's- ioners for the construction of a proposed Davie County office building. Contracts for the w ork w ill be awarded at another special meet-, t ing of the board on . Decem ber 28. The Barger Construetiori“C om ­ pany o f Statesville was low bidd­ er on the general contract at $79,- 876. T w o W inston-Salem firm s w ere also am ong tho low bidders. J. II. A llen and Sons made a $6,390 offer on the plum bing contract, and the Landingham Plum bing and Heating Com pany was low bidder on heating at $6,848, i s t m a s Santa Claus Expected To Arrive on Schedule The latest w ord from the “N orth Pole’ indicates that Santa Claus ^as Davie county on his itinerary 'or Christmas and fs expected to arrive on schedule. The latest w ord also indicates that Santa Claus did not forget W illiam Luther Cline on Route 3, M ocksville. W illiam ’s m other advises that her son has received the radio he wanted, a battery for it, and m any other gifts. For these she expressed her apprecia­ tion to all those w ho m ade this possible. As has been the custom in the pa'll, Christmas observances in the most instances w ill take place in the hom e; am ong fam ily and friend. Other Christmas observances o f churches and other organizations that take place this w eek are as follow s: M onlcigh Garm ent Co. The' M onleigh Garm ent C om - "p'any w ill hold a Christmas party for their em ployees on W ednes­ day afternoon, follow ing w hich they w ill close until Tuesday. Baptist Church The Junior Choir of the First Baptist Church w ill present a Christmas program on W ednesday follow ing w hich a Christmas tree with gifts will be held for the Sunday School. Rotary Club The annual Christmas Party o f the M ocksville R otary .Club was held Tuesday, night. It was fam ­ ily night with refreshm ents being §erved and gifts presented to the children by Santa Claus. Fork Episcopal The Episcopal Church at Fork w ill observe Christmas w ith tha follow ing activities. W ednesday night, Dec. 23, 7:3d a pageant “'The Light o f M en,” will be presented in the church follow ed by the children’s party in the Parish I-Iouse. Thursday night, Dec. 24, at 7:30' will, be the annual caroling w hich w ill be fololw ed by the Y P S L Party at the Parish House. On Christmas m orning at 9:30 the H oly Com m union Service w ill be celebrated by the Rev. L. G. Roberson, Priest in Charge. Concord M ethodist The Concord M ethodist Church, will have a Christmas program on Thursday at 7 p.m. The pro­ gram will conrist of the children’s and young people’s ‘Service of The Shell Electric Com pany of Statesville offered the low bid of $9,660 for electrical w ork on the building. Architectural and engineering w ork for the three story structure was handled by the firm of Lash- m it, James, Brown and Pollock of W inston-Salem , Representa­ tives of the firm were present for Thursday's bid opening, together with R. P. Martin, Chairman, and Com m issioner J, N, Groce o f the county board, and County A t­ torney A, T. Grant. The building w ill be erected on county property just south of the courthouse. It w ill house the w elfare department, the health department, library, farm and hom e agents and other agricul­ tural offices, and the county school adm inistrative offices. IT PAYS TO ADVERTISE W esley. Chapel The Christmas, program of the W esley Chapel M ethodist Church will be presented Friday evening at 7:30. • Cornatzer M ethodist The Cornatzer M ethodist church will have their . Christmas pro­ gram on W ednesday tit 7:30 p.m. Chestnut G rove M ethodist The anual Christmas program of Chestnut G rove M ethodist Church w ill be presented Friday, D ecem ber 25 at 7' p.m. Presbyterian Church A Christmas Cantata, "M usic of Bethlehem ,” by Fred B. H ol­ ton will be presented at the First Presbyterian Church in M ocks­ ville on W ednesday evening at 7:30, It w ill be presented by the Junior and .and Senior choirs. V.F.W. The V. F. W . will have a party at the hut Friday night, Jan, 1, at 8 p.m. A ll Veterans of F or­ eign W ars are urged to attend. St. John’s Dinner On December 31 The annual St. John’s Dinner, sponsored by the local M asonic lodge, w ill be held at the Jodge' hall on D ecem ber 31, at 6:30 p.m. Rey. E..M- Avette, Grand Chap- plain of Masons of North Caro­ lina, will be the principal speak­ er. PAGE TWO UJ<, IN .( t KNTKRPR1SK TUESDAY, DECEMBER 22,1953 The IS, i •' P u b lish ed i MR \Nt> («!'■ GORPON TO: En> • Cl>. ■: w r Vs'.'-'Ksvi:;; !>O W \t A.;. i!t •' '■ »vo! j-v~- Editor After jii j i s s the battle of Pharsalia (48 B.C.), lie showed a disposition to treat the Jews with favor. At this time Antipater wa's prominent in Palestine, and because of assistance rendered to Caesar in a campaign in Egypt he was handsomely re­ warded. He further entrenched himself in power by se­ curing appointments for his two sons, Fhasaelus as gov­ ernor of Jerusalem, and Herod of Galilee. Herod was a young man of exceptional ability and un­ restrained ambitions. Skilfully taking Advantage. of the events that followed the assassination of Caesar, and util­ izing a flight to Rome during an invasion by the Parbhians he was made King of Judea by the Roman Senate, and upon his return vigorously put down all opposition. It was Herod’s aim to spread Hellenistic civilization and completely to mold Judea' into the stipulated forms of the Roman Empire. From many points of view .he was large­ ly successful. He built cities and fortifications, erected statues and temples, promoted games, encouraged litera­ ture, and increased prosperity. He also built the Jewish temple ;a magnificient structure of the Greek and Roman type, equipped it for elaborate ceremonies, and organized a priesthood said to have numbered twenty thousand. However, his unusual ability was more than offset by his unbridled cruelty. The Jews were often short-sighted and narrow in their opposition to him, but whatever his oc­ casional liberality he mas a man who was justly despised and hated. His enemies were crucified and burned. He had no scruples about murdering the high-priest and even the members of his own household, including his wife. To order a slaughter of infants at Bethlehem was an act which would cause him no remorse. The majority of people of that day were the common folk—fishermen and shepherds, artisans and merchants— whose efforts to secure a livelihood demanded all their labor and time. The conditions of their occupation and living did not permit them to heed the intricate requirements laid down by- the Scribes and Pharisees, and consequently they were avoided by the “Separists” as “unclean” or “sinners who knew not the Law.” Their means of support were scanty arid uncertain, but they did not suffer from extreme poverty. In the small villages here were signs of thrift and quiet enjoyment. Many, however, suffered from disease and blindness, and such were likely to become beggars and fmfcca'sts. These people had long looked forward to a new and better day. This hope was sometimes held in restricted form as meaning abundant material prosperity or triumph over the nation’s enemies, but as taught by the great prophets the essential character of this new era was righteousness and peace. Its blessings were to be world-wide. These were the conditions 1953 years ago when Jesus Christ was born in that manger in Bethlehem. He lived and died for the ideal of “Peace On Earth and Good Will Amopg Men.” But even in that day the proposal of such an ideal was deemed to be too radical and a threat to the existing government. However, during his shoyt life Jesus showed the way to achieve true peace and happiness. By remaining true to himself and His God, He became a pattern for all man­ kind. As we observe His birthday on Christmas, 1953, we should look around us . . . compare conditions today with those 1953 years ago . . . then ask ourselves whether or not, in the things that really matter, have we really made px-ogress? Hymn 5s Burn/ ^1 B Y C U N T J B O N N E R ^ S ile n t N ig h t, H o ly N ig h t kA Priest Goes to See a Christmas Play Tl was it custom In Austria for roving groups of amateur actors to give plays in the mountain vil­ lages. As the organ in the little church at Oberndorf was broken and the mechanic from nearby Salzbuig had parts nil over the floor, a local shipowner con­ sented for the annual Christmas play to he given at his home. And, of coursc, Father Joseph Mohr was invited to see the show. The sincerity of the young actors touched the priest. After the play he went to the top of a hill that overlooked the tiny village. Alone, he pondered the wonders of the universe. It was a still, clear eight . . . a silent night. The next ’morning Mohr callcd at the home of Franz Gruber. Besides being schoolmaster, Gruber played the church organ . . . when it was in playing condition. Mohr handed Gruber a carol he had written. He might have it as a Christmas present Silent nighty holy night, All is ca/m, all is bright. Round yon Virgin Mother and Child, Holy Infant so tender and mild% ^ Sleep in heavenly peace. Sitent night, holy night, Darkness flies, all is light, Shepherds hear the angles singf ,f Alleluia! hail the King! Christ the Savior is born.” , . , and shyly suggested that lie try his.tianiJ at setting it to music. ! That night, Dcccmlicr 24, 1818, Father Mohr went to his little church for Christmas Gvc services. The organ fixer was there with apologies for not having completed his job. Franz Gruber was there . . . with his guitar and a melody he had written for Mohr's carol. They were young men, the priest and the musician . . . >26 and 31 respectively. Neither had written a song before and, so far as is known, neither wrote another. Gruber called Mohr to his Bide. He plunked .the strings of<his guitar and the two men sang a new Christmas carol. ... The organ fixer memorized it. Back in Salzburg he sang it for the Strasser sisters. The famous concert singers added it to their collec* tion of native mountain songs . . . and started it around'the world. Translated, English speaking countries know it as .. . Silent nighty holy night, Guiding star, lend thy light; ’ . See the eastern wise men bring Gifts and homage to our KingI Christ the Savior is born. Silent nighty holy nighty Wondrous star* lend thy light{ With the angels let us sing ,rAlleluia to our King/ Christ the Savior is born,” Fro/*, the Bouk, I Reflections Of 1 Christmas w The rnow was fal.ing steadily, oftly. Little piles w ere already eaped on high, spots and soft luffs w ere clinging to the tips of he trees’ bare limbs. It was just at m idnight, that nistic hour when thing", of the i’orld are dim m est and things of truck lo got m e out here, took fou r- men to set me up. I was in a. big hall, had lights all over m e -n d hundreds ot' folks cam e to see me and there was singing and tw o Santa Clauses— I was a com ­ m unity tree. M ighty proud of m y job to but I must say its a pretty nature are most w ide awake. A t thankless'one. They sat m e upr ’;hat hour "on Christmas Eve the animals all talk, one to another, pouring out their tales of love, if loyalty, of lonliness, of hurt, A t such an hour on the New Year’s eve the little furred things fhat m ove through w oods and 'icld, stop for a m om ent and look out with all-seeing eyas upon the w orld about them, up into the heavens ,and even, so the story «oes, on beyond. But this was not Chri-tm as. This was not the eve of the N ew Year either. This was just at m idnight of the day that the Christmas trees w ere thrown away. Christ­ mas was over and that day the trees had been cast out. One by one they came, som e in cars, som e piled high on city trucks to b e.p i!ed into this va­ cant field. Som e lay with grace­ ful tip aloft, still sym etrical and beautiful, som e w ere roughly da-.hed dow n with harshly cut trunk standing up, slender, brittle limbs crushed and broken beneath. There was gay color in the pile, the softness of pastels, the gleam -w 1'* " 1 - — vv^COX-l'OLLKTT CO., Chicago, Illinois. was the natural. green of fir, pine Is There A Santa Claus? The following is the famous editorial written for the New York Sun by Francis P. Church, Sept. 21, 1897. We take pleasure in answering at once and thus prom­ inently the communication below, expressing at the same time our great gratification that its faithful auhor is numbered among the friends of “The Sun,” “Dear Editor—I am eight years old.' “Some of my little friends say thex-e is no Santa Claus. “Pappa says, ‘If you see it in The Sun it’s so. “Please tell me the truth, is there a Santa Clans? VIRGINIA O’HANLON “115 West Ninety-First Street.” Virginia, your little friends are wrong. They have been affected by the skepticism of a skeptical age. They do not believe except what they see. They think that nothing can be which is not comprehensible to their little minds. All minds, Virginia', whether they be men's or children’s are little. In this great univex’se of ours man is a mere insect ,an ant, in his intellect, as measured by the intelligence capable of grasping the whole truth and know­ ledge. Yes, Virginia, there is a Santa Claus. He exists as certainly as love and generosity and devotion exist, and you know that they abound and give to your life its beauty and joy. Alas- How dreary would be the world if there were no Santa Claus. It would be as dreary as if there were no Virginia. Thex-e would be no childlike faith then, no poetry, no romance to make tolerable this existence. We should have no enjoyment except in sense and sight. The eternal light with which childhood fills the world' would be extinguished. Not believe in Santa Claus! You might as well not believe in fairies! You might get poor pappa to hire men to watch all the chimneys on Christmas Eve to catch Santa Claus, but even if they did not see Santa Claus com­ ing down, what would that prove? Nobody sees Santa Claus, but that is no sign there is no Santa Claus. The most real things in the world are those that neither chil­ dren nor men can see. Did you ever see fairies dancing on the lawn? Of course not, but that’s no proof they are not there. Nobody can conceive or imagine all the wonders there are unseen and unseeable in-this world. You tear apart the baby’s rattle and see jvhat makes the noise inside, but there’ is a veil covering the unseen world which not the strongest men that ever lived, could tear apart. ■ Only faith, poetry, love, romance, can push aside that curtain and view and picture the supernal beauty and glory beyond., It is all real? Ah, Virginia, in all this world there is nothing else real and abiding. No Santa Clans! Thank God!' He lives ,and he lives forever. A thousand years fx-om now, Virginia, nay ten thousand years from now, he will continue to make glad the heart of childhood. '.W .V .v 5 ‘.V 60 Second Sermons By i'ltfcU. liOUUE Text: “ The w rong w ay always reems the m ore reasonable.” — G eorge M oore. Charles the V was determ ined to com pel his subjects to adopt his w ay of thinking about relig­ ion. Thousands died rather than conform . '/ . W eary of a long reign, Charles abdicated in 1556, and retired to a m onastery, w here he amused him self by trying to m ake a doz- 3n clocks run absolutely together. W hen, he failed, he exclaim ed, “ H ow foolish I have been to think that I could m ake all men believe alike about religion when [ cannot m ake even two clocks run together.” 8 '.% W .■ *-■1 Ike’s atom speech was Baruch's idea. .V .W .V .V .V .W .V A V .V .W . ence. Attorney General B row nell's hopes for enactm ent of bills leg­ alizing wiretapped evidence (as Dem ocratic pitch on anti-Com - munism: FBI gets 30 times as m uch m oney 18 times as much m anpower as in 1032; Red Presi- Each of us is “ king” of some kingdom . It m ay be a single room , a hou-e or a business. W e m ay rule only ourselves, a sm all | fam ily; or it m ay be a group o f' friends or business associates who look to us for leadership. Y et w e 1 •are “ king-.” H ow w e rule our kingdom s is im portant. From ou r( .UiUjj-.kingrtonis m ay rnm e..great kings w ho w ill rule w or’ ds. W e m ust guard against a natural de- ^ sire to force others to conform to a pattern because we’ believe it ^ lo be be-t. W e m ay teach basic truths by w ord and exam ple. Be-1 vond that, others have ideas, ideals and goals. M any w ould rather die than be forced to em brace ours. folks cam e that night, then next: day som ebody needed the hall so- they shoved m e out. O f course,. I’m an old tree. I’ve seen these Christmas tim es com e and go— i’ve seen the trees, big and little ones so proud to be chosen go­ ing off so gay and green and I’ve seen them dum ped back out hero- too. Its nothing m ore than I ex­ pected. O f couse, if I hadn’t been the finest one in the forest I w ouldn’t have been chosen, I take what good I can from that”— and his voice trailed off with a sound like pine needles scraping one- against the other. “Hi, littlest tree over there w here did you com e from ”— and, in answer the littlest tree, a pink one, spoke up, a m ere sound in. the night— “I, Oh I was just a bedside tree for a little b o y in the hospital. But he loved m e, didn't want m y lights turned o f f at all. Poor, little boy. I stayed longer than he did. T hey carried him out a w hole day before they took m e away. It was short, m y Christmas, but it was lovely. His- of rilver, the w hite that was onej little hands reached out to me, with the snow and here and there, his eyes w ere shining” and the voice o f the littlest tree drifted, with the snow. “ A nd you, litle green tree,, didn’t they trim you at all?” ' “Trim m e— indeed she did. But. the lady didn’t want m e colored,, or even tipped w ith snow. She- wanted m e like all the other trees- she had at all the other Christmas; times and _she trim m ed , m e w ith the ornam ents o f those other Christmas days. Right at. the top- she put a star. The lady had the- -tar in a box all by itself. It was- a bit tarnished. She ran her fin­ gers over it w hen she took it from the box. ‘H ow m any tim es’ she- said and she was surely talking to­ me for no one else was there,, ‘how m any times.’ Our baby, our- little boy had it for his first Christmas and I’m sure he notic­ ed it* I rem em ber his eyes so big, so brow n— so long ago, so long- ago— and I felt her w arm tears on by boughs as she fastened the r.tar to m y topm ost branch and T shivered clear through and th e star sparkled in the firelight and the lady sm iled a little, even w ith the tears in her yes and saidr ‘Dear little Christmas Star,.” Every tree was still. F or Christ- * mas trees have hearts,, you know ,, w hen they talk at m idnight on that one night, a n d th e ir hearts' were sad for the little lady all alone with the Christmas star o f other years. , A nd then bright, crisp, cheerful cam e a voice that said, “W ell, I had a m arvelous Christmas. I had popcorn on m y branches and cotton for snow and gay paper trim med m e and there- was a doll carriage on one side of m e with a doll in. it and on the other was a little train and a. drum and the m other, little w ith a bright apron tied around her. reached up and kissed the daddy as she stood and looked at m e and he hugged her and they laughed and cedar. And it was m idnight there as the ••now fell on the trees. Sudden­ ly there cam e a stirring, w his­ per of m ovem ent and a sound of words, so soft they seem ed a part of the softness of the snow y night. “I'm afraid this dam pness will m ake m y co’ or rim. Everything was blue this year. They had m e colored by a real artist. The lady refused three times the ones he did be'cause the shade was not right and then at tw o o’clock one m orning he finished m e and when she came next day she said I was right and paid and took m e hom e. P oor man. He spent so m uch lim e and w ork. I hope he sold the others top. The room was love­ ly w here they put m e up, all blue and silver and I had an angel with its wings outspread and each w ing had a tiny lighted star. It was fastened to the tinest twig at m y topm o-t tip. I held very stiff and still to keep the angel just like the lady wanted it, never a needle bent or broken. It was hard. The lady was tired too and the gentle­ man said ‘W hat’s the sense in all this fuss— half o f them w ill be pa~.t- know ing tom orrow night whether its brow n or pea green; •snd he laughed and went to bed and the lady was mad. But she finished m e up so beautifully and the next day crow ds cam e in and out and everybody said, ‘H ow ,'ovely' and they asked w here I came from and I was proud. That night they had soft lights all over m e and m ore people came but next day the lady and gentleman w ere there alone and they w ere not very gay. He slam m ed dow n his paper and said ‘W ell, let’s get it out of here— this Christmas business makes m e sick’ and then the house was still and no one cam e and today a servant took the ^ and she' said, ‘Isn’t our tree ju st and she didn t unpm them, she beautifu r_ ancJ he said; -0 ur tree- just broks twigs and all Then a|js the mQSt beautifu] one in the man dragged m e down he steps w or]d and QUr m t,e fam i] . the. and threw me in an alley— and adm issable in certain federal| dential candidate got 102,995 votes, court cases) is doom ed according then; and only 24,740 at peak of to opinions of m any in W ashing- N ew Deal-Fair Deal era. ton. He can blam e his handling | of the Harry D exter W hite case,’The Am erican Legion and the Am erican M edical Association ap- The Randall Com m ission on pear headed for a big collision Foreign Econom ic P olicy is hav- over cutbacks in Veterans A d- ing trouble trying to produce a m inistration m edical and hospi- suitable tariff program for Ike. 1 talizalion services. Too keep pace with the na­ tion’s rapidly grow ing population Am erican industry must create 1,000,000 new jobs a year for the next 20 years, according to Earl Bunting of the National Associa­ tion of m anufacturers. Bunting predicted that the nation’s pres­ ent labor force of 65,000,000 w ill rise to 87,000,000 by, 1975. Rum ors, probably N ATO - in- G ov, Dan Thornton of Colorado spired, hint that the United States has asked the Colorado Legisla- m ay low er the priority on Span- ture to consider a proposal that all] ish defense bases, using lack o f autom obile owners be required j funds as one excuse, . to install recording speedom eters,; --------------- 'w h ich w ould m ake a perm anent. U. S. M obilization officials have record of all speeds traveled. Per-1 com pleted plans in W ashington iodic inspections w ould be m ade' for the evacuation of all A m eri- by the State and if the speedo- can civilians in Europe — if ever m eter showed any speed in ex*' necessary. These plans w ere shap- ces o f the legal lim it ,the m otor­ ed by U. S. executives at confer- ist w ould be fined. In an address for the annual convention o f Investm ent Bankers Association, Secretary of the Treasury H um phrey declared that if large cuts in Federal spending are to be m ade next year, they m ust be carved out of national security outlays. Otherwise, the Governm ent w ill run $8,000,000,- 000,000 or $9,000,000,000,000 in the red next year. IT PAYS TO ADVERTISE they brought m e here. I was so lovely— this blue on me is very fine— I was proud they picked me but I didn’t know being a Christ­ mas tree was just- like this — I thought it was different.’’ “ It is — Oh, it is different.” A nother - voice spoke up, “ Here I am, I’m the w hite one, the snow has m e most covered over now but it was a w onderful Christmas, arid the snow is soft and warm over me. I don’t really mind if I was brought out here. A fter all they w ere sorry to see me go, the ’ittle children stood in the door nnd watched and they all wished I could be left just a little long­ er. They had beautiful things on me and w onderful toys and it was just daylight when everyone came running in to gather about m e and every body was so happy and ex ­ claim ing how pretty I looked. Oh, it was grand being a 'Christm as tree and I’m sure if I had to be taken out, the children w ill never forget m e,” “ Ah, you poor little bright things. Y ou think you know , but look at m e. It took one w hole happiest and m aybe next year wer w ill have som e real lights.’ Oh, I was so proud and so happy, r just wished I could w ave every green twig on m e to show them I was glad to be a part of such a real, real Christmas. Came a rush o f wind, far o ff the sound of a rooster crow ing-— . ‘but what’ a rose tinted tree w his­ pered from under the m a-s that had broken and m arred her beau­ ty— ‘‘W hat becom es of us now — is this the end of CJ-.r'- 'n a s ? ” A nd the w ind w histling , vthe . snow fields took up the faint words and carried them on and the pile of Christmas trees, the pastel ones, the silver ones, the white ones and the green, shook as the wind passed by and here and there a few dry needles fell. The new heavy bom l/er, the B52, is ‘‘faster” than even the sw ift m edium B-47, w hich has flow n 656 m iles per hour, accord­ ing to R oger M. K yes deputy sec­ retary o f defense. The first pro­ duction m odels w ill-b e delivered late next year, accorling- to K y^s. TUESDAY, DECEMBER 22,1953 THE MOCKSVILLE (N. C.) ENTERPRISE PAGE THREE •kfc*»»S»Sl»SH»StS!&!5l3lSl»SlS>»aaSlSia»lS!5l»i3!»!Si2)2:SS!3l»S!S!S!S)»!»3)Sl»»S!»aSl»ft»S)»3i2!S!»»»»St»Si9lSi3!Sii| 1 Thank You Mr. and Mrs. Public! FO R Y O U R G RA N D R ESP O N SE TO OUR RE-O PEN IN G L A S T S A TU R D A Y m _ _________________________ S i Roger Parrish W. V. Eaton E. B. Howard Clyde Studevant Fred T. Holman Billie Rucker Robert L . Safley Andy Fowler Gene Flowers J. H. Markham | Here are the names of the persons who won F R E E B A S K E T S O F G R O C ER IES : Henry Austin Robert Gaither R. J. Smith W illie Joyner Paul AngellM IMf J«!«ieieteici«i«ie«teisi6i6«ieists!eisis!g!e>«i«!eiafs!e!aisie<s«'e‘s|«!« « ts!s « ,e!s,eleis!sief1«!s*8«i«ieie!«isieici«ieiii«'«*ien H U R R Y B A C K TO S EE US Kiger Self-Service Grocery North Main Street Mocksville, N. C FHS Echos B y SH ERRILL BRIN K LEY & EM M A SUE ALLEN The Beta Club held a m eeting M onday night, Doc. 4, 1953, at the school hom e ee. building. Plans w ere m ade for getting the ■■chool paper out before Christ­ mas. The paper, which was named the B lue D evil’s Soundoff, w ent on sale W ednesday. A ll the copies that w ere m ade w ere sold and others had lo be made. R oge? W allace was given a box of can­ dy for nam ing the school paper. Plans for the H om ecom ing were discussed and made. The Beta Club decided to give the girl w ho was crow ned H om ecom ing Queen a gift. Because of the rainy w ea­ ther, Rat Court, ‘w hich was set for M onday night, was postponed until Jan. 4, 1954. The Junior Class gave an en-| joyable Christmas program for- chapel in the school auditorium , Thursday, Dec. 17. A Christmas i message, poem s and Christmas songs w ere preented by them. The Blue Devils of Farm ington w ere In R ockw ell on Tuesday night of last w eek for a double- header w ith the strong Row an County teams. The girls suffered their second defeat o f the sea­ son, 44 to 39; but the boys got back on the w inning side by w inn­ ing, 42 to 40. The hom e com ing game at Farm ington ' was a ,big success. B oth the boys and girls teams w on over the strong R ockw ell teams. The girls score w as Far­ m ington 23, R ockw ell, 13. The boys’ score was 52 to 38 in favor of Farm ington. The Farm ington girls got an early lead and held it through­ out the entire game. Only once did R ockw ell threaten and that was at the half-tim e w hen the score was 10 to 7. Em m a Sue A llen racked up 19 points for the winning team and N. I-Iols- houser put in 6 points of the 13 that the R ockw ell girls had. The boys grabbed an early lead and kept it all through the game. Johnny B oger and Francis Ellis w ith 19 and 14 points respectively, lead the Blue D evils in their- vic­ tory. Vanhoy with 11 points led the scoring for the losing team. The honor of being crow ned the hom e com ing queen of Farm ing­ ton high school w ent to D orothy Reavis, a junior, and an outstand­ ing student in her class. She is also on the ball team and plays left forw ard for the Blue Devils. D orothy was crow ned during the half time o f the boys’ gam e by co-captains Johnny B oger and Bill W alker. She was presented with a bouquet of red roses by the stu­ dent C ouncil President, Sherrill Brinkley. A gift from the Beta C lub was presented to D orothy by Sherrill Brinkley. The queen’s attendants w ere: P eggy Davis, Betty Carter, Jo Anri Bowles, Jean Sharpe, P eggy Coe, W inifred Davis and M arie Absher. CARD OF TH A N K S W e wish to thank our friends and neighbors for their kindness shown us in the' recent death of Jesse Dalton Nail. M R. AN D M RS A. E. BOW EN S & FA M ILY. C O M E S E E I T 8 F i r s t a n d o n l y l o w - p r i c e d c a r t o b r i n g y o u a l l t h e s e n e w f e a t u r e s a n d a d v a n t a g e s ! No*! POWER BRAKES First in the Low-Price Fieldl Chevrolet Power Brakes make stopping won­ derfully easy and convenient. Optional at extra cost on Powerglide models. AUTOMATIC W IN DO W AND SEAT CONTROLS M ore Chevrolet "Firsts” ! Just touch a button to adjust front windows and seat to your liking. Optional on Bel Air and “Two-Ten” models at extra cost. NEW POWER IN "BLUE-FLAME 1 2 5 " ENGINE Most Powerful in its Fieldl The most powerful Chevrolet passenger car en- •• gine ever built! Amazingly econom ical, it’s teamed with Powerglide, optional at extra cost. NEW POWER IN "BLUE-FLAME 11 5 ” ENGINE Out-Powers All Other Low-Priced Carsl In gearshift models, the more powerful “ Bluc- Flainc 115” engine gives you finer performance with money-saving gas mileage! NEW STYLING IN BODY BY FISHER Another Chevrolet Exclusivel New front- and rear-end styling. A ll around the car you see new beauty in the only Fisher Body in Chevrolet’s field. < Nav! FINEST, MOST COLORFUL INTERIORS in the Low-Price Fieldl Here arc the most luxurious interiors on any lowipriccd car! New interior color harmonies are keyed to brilliant new exterior colors. Nsw! LOWER PRICED POWER STEERING Another Chevrolet "First"! First in its field with Power Steering, Chevrolet now reduces the price. Optional at extra cost on all models. Nav! CHEVROLET’S EXCLUSIVE POWERGLIDE ' Now for All Modelsl N ow you can have smooth, thrifty Powerglide on any model. Teamed with the “Blue-Flame 125” engine, it’s optional at extra cost.o f e More tfiingi more people want, lhat’t why MORE PEOPLE BUY CHEVROLETS than any other carl Pennington Chevrolet Co., Inc. “I ’m giving you a well trained maid for Christmas. She’ll work for you many years and you won’t hve any trouble with her!” How would you like to say that to everyone on your Christmas list? Today you can give such a gift . . . by giving an electrical servant. Elec­ trical appliances make daily activities more pleasant for everyone in the family. May we offer you the following suggestions of items available at our store . . . J General Electric T R IP L E - W H IP M IX ER $44.95 General Electric SAN D W ICH G R IL L $16.95 (g!gigigis!s«(eigieieie!eie!g>gieieiei£ieigietei5ieis«ie«ieie>et« General Electric Swivel Type V A CU U M C LE A N E R $89.95 Doremeyer E L E C T R IC D E E P F R Y E R $29.95 Motorola RA D IO & R EC O R D P L A Y E R CO M BIN ATIO N $99.95 <e'gts<ste«'eteK:'ete'e'etete«'ctetctctc>etc'«tetcie>gta!c<c'cte« Symphonic E L E C T R IC PH ON O GRAPH $22.95 iztemtsieicietS'etetstsisKtstex'e'eieizietv’eie'eiewetem ttit v General Electric r A U TO M A TIC IRONS $12.95 STEA M IR O N S .........$18.95 . <gisie!e<e!£!eis<eiets«>s««,«tate«i©e<€©e!s‘e<e'e‘e!£««'e‘e General Electric Automatic POP UP TO A STER S $23.95 leigisigisisicteisteieieieisisieteisistetessisigieisieig'ciet Complete line of H O T P O IN T ----- &it H O U SEH O LD A P P LIA N C ES XxxRaXXX« XaxxRXX latgieigteteietstetgicteieisigtsifiisietsteicicieietsieisietcieicieicsoiasiaaasiasi C O M P LET E L IN E O F FU R N IT U R E AND H O U SEH O LD FU R N ISH IN G S Assorted Lamps — Tables — Chairs — etc. te te tsie « « teicstsicistsicus’-eiste wneie’ei® ie se i«te te « !e<e«!«!C!S StepOn G A R B A G E CA N S Full line of Lane C ED A R C H ESTS PHONE 156 MOCKSVILLE, N. C. $6.95 g} $6.95 K'eic'c>c>s«'c>s«‘-e<e«icteic'c<<tc'c«<c'cicicie«'c>c'c<c'etei(:'3'ete<e>ete!e'ci&< D a n i e l _ F u r n i t u r e & E l e c t r i c C o . PH O N E 198 M O C K S V ILLE , N. C. I IIII PAGE FOUR THE MOCKSVILLE (N. C.) ENTERPRISE TUESDAY, DECEMBER 22,1953 US News By ED ROWLAND Christinas spirit was really in the air Friday as school lot out fo r the holidays. There w ere pres­ ents for all the teachers, anl treats given by the P T A to all the student'?. In m ost of the gram m ar grade room s there w ere parties, com plete w ith Christmas trees, gifts and food. A ll the stu­ dents had a good time, but they w ere glad to get a vacation before m id-term exams. Concord D ecem ber 8 the M ocfcville W ildcats went to W oodleaf and split a pair o f games w ith the G reen Rockets. M ocksville girls, . came away on the short end of a 4 4-18 score, but the boys evened | t.Mncs up by -notching a 52-51. thriller away from W oodleaf, j M ocksville got off to a fast start) start, but W oodleaf clim bed up, close in the final period to make an exciting game. On Dec. 11, a A A school from Forsyth County cam e to M ocks­ ville f>nd walked of w ith a pair o f sarrna, girl1?’ 21-34; and boys,, 43-67. M ocksville girls couldn’t seem to (Ret started against the strong visitors, but in the second h alf they .heVl Mineral Springs dow n to 8 points w hile they scor­ ed 13 to pull close. In the boys’ contest. M ineral Springs’ tall t"am just outscored M ocksville in the point-m aking end of the game, but they certainly didn’t display any better floor w ork than the W ildcats did. ■Last Tuesday night W oodleaf played at M ocksville in the re turn engagem ent betw een the tw o teams. The W ildcats outplay­ ed the visitors in both games to w in by one-sided scores. The girls’ score was 30-8; and the boys’ w as 46-32. M ocksville’s guards in the open­ ing contest w ere overpow ering as they allow ed no points in the last quarter and only eight in the w hole gam e while Lena Cornatzer was sparking the forw ards with 18 points. G ene Poplin led the scoring for the boys with 24 points as M ocksville routed the visitors, w ho never w ere in the game. M iss Joan M urray and the G lee ‘'Club presented its Christmas Tprogram the the P T A m eeting "last M onday night. A ll attending "ivere very com plim entary about :the program , and congratulated :al] tjib® singers on a fine presen­ tation. , . ' Tho Concord M ethodist Church w ill have its Christmas service Thursday, Dec. 24, at 7:15 p.m The program w ill consist of the children’s and young people’s “ Service of Lights.” The Hom e Dem onstration club n et with Mrs. Frnnk Crotts and ’'Trs. Bill Spry, Friday at 2:30 for their Christmas ' party. Gifts were, exchanged and it was decid­ 'd to fix a box for the patients at 'he Nursing Home. The Co-w orkers class m et at the hom e of Mrs. Lester Dwiggins. Mrs. Hom er Crotts presided and M r”. .Bill Spry was in charge of the program , M r. and' MriS. Sam Berrier and Mr. and Mrs. H om er Crotts vis­ ited Mr, and Mrs. Buck Berrier Sunday. Mr. and Mrs. Raym ond Daniel and Diana and Mr. and Mrs. Sam Daniel of Liberty visited Mr. and Mrs. S. D. Daniel Sunday. ' M r. and Mrs. A be H oward of Bethel and Mr. and M r«. H om er Ho'dgin of Cooleem ee visited Mrs. Crotts and babyi, M rs. Billght Mrs; Duke Tutterow, Mrs. Henry Crotts and baby, Mrs. Bill Spry and Mrs. J. N. Tutterow ".hopped in Salisbury W ednesday. A num ber o f friends gathered at the hom e of B oone Foster and gave him a surprise birthday dinner Sunday. Mr. and Mrs. J. N. Tutterow attended the National Guard bar­ becue at the R otary Hut Tuesday night. Turrentine The sm all children w ill render a Christmas program at the church Christmas Eve night at 7 p.m. The W . M. TJ. m et Thursday night at the hom e of Rev. and) Mrs. E. F. Eagle for their De-> cem ber m eeting with 18 m em bers present. A fter the m eeting gifts w ere exchanged. A 3-C Norman G. James, sta­ tioned at Tampa, Fla., is spending the Christmas holidays with his parents, Mr. and Mrs. Carl James. Mrs. Charles Jam es left Thurs­ day by plane to be w ith her hus­ band, w ho is stationed at Fort Lewis, W ashington. ( Mr. and Mrs. F elix Reavis of M ocksville visited M r. and Mrs. Johnnie Lagle one night last week. IT PATS TO ADVERTISE j • * X i i 1 This Is The Place I1 s for you last minute I ers | vs 9 Men’s C U F F LIN K S .............$1.50 g • Men’s TIE PINS........... ..... .$1.50 | g • Eversharp PEN & P E N C IL S ET S $8.75 g O BILL FOLDS .................................$2.50 I ■ i © Ronson CIGARETTE LIGHTERS § SI (Still time to have engraved before * | Christmas) ^ y 9 ID EN TIFIC A T IO N B R A C E LE T S jj (Can be engraved for Christmas) S AN ABUNDANCE OF NICE JEWELRY f GIFTS gy ---------Come in and let us help you.---------- | r Q y U m Z L WATCH SHOP j? “On The Square” Phone 247W sJ "M ike,one to use more Smitb-Douglass Fertilizer. .. I want a new rug."" Surest way to increase profit in 1954 is through increased yield per acre. Surest way to increase yield is the proper grade of Smith-Douglass Fertilizer at the recommended rales. $1 worth of S-D produces average increased yield worth more than $}! High-quality S-D Fertilizer of the right grade and in the right amount reduces unit production cost by increasing yield and quality per acre. Let the nearby S-D Fertilizer representative help you keep your income up! Smith-Doaglass Fertilizers Listen to DEBNAM VIEWS THE NEWS 12:45-1:00 daily Christmas Greetings! W E W ISH TO TH A N K OUR CU STO M ERS FO R T H EIR PA R TO N A G E D U RIN G 1953. We hope that we may continue to s serve you See us for— . C U T FLO W ER S — C EM ET ER Y .. . W REA TH S, P O IN SETTIA S AND F L O R A L A RR A N G EM EN TS for CH RISTM A S. M ER R Y CH RISTM A S AND A H A P P Y N EW Y E A R TO YOU!f Siler Flower Shop Phone 113 Mocksville, N. C. C2 tggts<gtg'gig;e<g!giggte!g!gigigtgigtg;gtgigigisitigis:gigicig-gtgnitigigntcitigigigigKteictstg»eigmgigttisignmKtPcic«niciciiiB BEFO RE YOU BUY y ft K K N EW C A R - A S K YOU RSELF TH ESE 5 Q U ESTIO N S C4- OPV.. E C O N O M Y . . . An independent auto-testing organization drove three AERO WILLYS cars, with overdrive, through all 48 states, covering more than 90,000 miles. On gas, they averaged better than 30 miles per gallon. And total operating cost was less than a penny a mile! S A F E T Y ... "Motor Trend” magazine has published ratings of 20 lead­ ing American automobiles on safety. They picked AERO WILLYS as the safest car of them all! Modem, aeroframe construction... good visibility ... low center of gravity ... all make AERO WILLYS safer for you! C O N S T R U C T IO N . . Most automobiles are still made the old-fashioned, "two- | piece” way—by just dropping a body onto a frame and % bolting them together. AERO WILLYS is made the modem i "aeroframe” way—one sturdy unit, for greater strength < and safety, less body noise. V IS IB IL IT Y ... From the driver’s seat of an AERO WILLYS you can see all four fenders. This means safer driving, and much easier parking. Visibility forward is another1 big safety factor— you can actually see the road ahead of you as close as 10 feet in front of the car. C O M F O R T .. . AERO WILLYS gives you "small-car” economy —but "big-car” comfort! You get more than five full feet of seating width in both front and rear seats. And you can drive around curves without that uncomfortable feeling of sway or roll you get'in most ordinary cars. CAN A N Y CAR IN AMERICA A T A N Y PRICE GIVE YOU ALL THESE ADVANTAGES EXCEPT THE BEAUTIFUL y f e m j f w y s FURCHES MOTOR COMPANY DEPOT STREET MOCKSVILLE, N, C. TUESDAY, DECEMBER 22,1953 PAGE FIVE Cotton Marketing Quotas Approved In This Comity D avie County farmers, voting in If the farm ers had voted against 15 tovvnr.hips o f the county, voted the quotas, the allotments w ould 204 to 110 in favor of production be in effccl just the som e for control and price support in 1054. 1954 and the level o f price sup- The referendum was hold on port would bo only 50 per cent .Tuesday, Dec. 15. In tho state the of parity for those keeping to al- vote was 46,225 for and 2,142 lotments and no price support at ••against. T lie referendum decided pro- 'Suction quotas, the vote being lo r, or against, acreage reduct­ io n . Each cotton farm er was giv^ •en before the election, a notice ■of liis proposed allotm ent /fo r 1954 and there was an open m eet­ in g in the court house when the proposed reduction allotm ent ,and reason for it was explained. The ■explanation is that there is ex­ pectation o f an excess amount of ■cotton for 1954,-an excess of over four m illion bales over norm al :supply. The law requires the sec­ reta ry o f agriculture to call an ■election to decide quotas w hen "the current crop and the imports, plus any carryover, exceeds do­ m estic consumption and exports, plun a 30 per cent for reserve. 'This is what it going to happen in 1954, experts say, so the elect­ ion was called. The quotas o f acreage set up for 1954 are cut on the basis of the acreage, each farm er had dur­ ing the past three years. The last year when quotas were in effect w as in 1950. B y voting "for the reduced quo­ tas for 1954 the farm ers voted for •a price support of 90 per cent -o f parity if they keep in their alloted acreage, with a penalty o f 50 per cent o f’ cotton price on June 15, 1954* if they -go above their alloted acreage. K I- J •I■ fa Mm 1 1f1| $ * $1 ■fr$■aHi« iS«M £ 1 .'45 . ii 1 FASHIONS Corner Liberty and Third Streets In Winston-Salem ■^gigicigicigigtgtcgtgteTOetgteegigtgigigigistgigigigjgigigigigig^gigieigigigig’sigteigigigtgig Make it merry... have plenty of Coke all for those exceeding allotments. The support price on cotton now, In terms of m oney, is about 33 cents a pound, this w ould have dropped to 18 or 19 cents is con­ trol by reduced quotas had not been approved. S C H ED U LE G IV EN FO R B O O K M O B ILE FIRST TH U RSDAY, RT. 2 •Leave M ocksville 9 a.m.; B enn­ ett’s store, 9:20; Farm ington school, 9:40; Bahnson Home, 11:- 40; Smith Hom e, 12:40; James H om e 1:00; K ing’s Store, 1:30; Esr.ic Hobe, 2:00; Smith Home, 2:20; Cook Home, 2:30; M ocks­ ville. SECOND W EDNESDAY, RT. 3 Leave M ocksville 9:00; Cornat­ zer store, 9:20; B ixby,; A dvance ■ School, 10:00; Faircloth Home, 12:00; V ogler’s Store, 12:30; B ail­ ey’s Store, 1:0*0; Tucker’s Home, 1:30; Y oung Hom e, 2:00; Fork Church, 2:40; M ocksville. SECOND TH U RSDAY, RT. 4 Leave M ocksville 9:00; H endrix home, 9:20; Smith G rove: C law - . son hom e, 9:45; Smith Grove School, 10:10; Taylor hom e, 12:30; Poindexter hom e, 1:20; Hartman home, 2:00; M ocksville. IT PA YS TO ADVERTISE aiaaaaaaaaaaaaaaaaaaaaaaaaasniaaaaaaaaaasaasjaaaaaaa G IV E . . . Lovely Nylon Lingerie ■ T H E P E R F E C T G IF T from MOTHER AND DAUGH TER ■ ■■F,. A S H IONS in Winston-Salem ■ W e’ve a glamorous collection of beautiful nylon tricot undies— gowns, from $5.98, panties from $1. Petticoats from $2.98 and slips from $2.98. A ll purchases, boxed arid gift wrapped free fcOTTUD UNDER AUTHORITY OF THE COCA COLA COMPANY W W INSTON COCA-CO LA BOTTLING COM PAN Y Is n registered trade-mark 1953, THE COCA-COLA COMPANY includes: 5 -FT . CAST IRON BATH TUB A V A L U E , W E B E L IE V E U N S U R P A S S E D ! • 5-FT. CAST IRON BATHTUB . . . Recognized as better than steel! • LAVATO RY . . . Handsome, modern design! • COMMODE . . . And tank of the finest quality. Close coupled style! • Complete with all fittings to floor or wall! LO W E’S LO W , LO W PRICE 5 4 I N C H D O U B L E D R A I N B O A R D Plate Glass All mctnl medicine cabinet, size 14x20x3'/’* inches, wllii removable glass shelves, in gleaming while enamel . . . plate glass mirror is lflxJM inches . . . a tremendous value at LOWE'S LOAV PRICE OF: COMPARE IT WITH OTHERS! Then you’ll see why LOWE’S consid­ er this a Super Value! Porcelain on steel, double drainboard sink and cen­ ter bowl . . . heavy gauge steel cabinet base . . . 2 cutlery drawers, 4 com­ partment doors . . . re­ cessed base . . . and . . . L O W E ’S L O W P R IC E Complete - with Spay and FittingsI SHOW ER STA LL Full standard size, all metal shower stall with durable con- . crete - composition base . . . comes complete with all fittings lurtced way, way below other comparative showers. AT LOWE’S ONLY . . . *45 Beautify Your Bath and Kitchen! V4*>nch tempered tileboard with baked-on enamel finish that won’t crack or peel! In 4x4 foot sheets . . . easy to install , . . the per­ fect way to’ beautify your kitchen or bathroom A T LOW COST! Smooth back with.scored front in 4x4 inch tile blocks. Mirror smooth surfarg cleans with a cloth! ' COLORS: White with Kell Lines White with Black Lines Blue with While Lines Green witli White Lines l'eilow with White Line* A T L O W E ’S 2 3 P er Sq. Ft. ANYONE CAN INSTALL ORANGEBURG the lifetime PIPE for HOME and FARM m i Its 40 year record underground proves the quality of OIlANGKnUItG PIPE! Once installed, it gives lifetime service In house to sewer, to septic tank, downspouts and other underground non-pressure uses. 4 Inches in diameter and 8 ft. lengths . . ■ with connecting coupling , , ,2 8 Per Foot L O W E ’ S iorih Wilkesboro Hardware Inc. NORTH WILKESBORO, N. C. )PPOSlTE POST OFFICE PHONE 389s PAGE SIX THE MOCKSVILLE (N. C.) ENTERPRISE Circles’ Christmas Party Mr. and Mrs. Jeff Caudell Smilh and Mrs' N\R> Dnvia- The m -tubers of Circles 3 and A r e ITost9 at Y llle Dinner^ Ru°n ca!' ■ ^ “ ..nnswoi^d with 4 of the W om an’s Society o f m e n 0 s t ;s al.x Uie dinner, each m em ber tel.ng of one Christ- Christian Service of the First Mr. and Mrs. J eff Caudell w ere mas they rem em bered most, fol- M ethodist Church enjoyed an hosls at a Christmas dinner Sat-, low ing which the group had fun outstanding Christmas program urday cveninB at their hom e on 'and games directed by Mrs. J. D. W ilkesboro Street., The hom e was Hodges. Prizes w ore w on by M es- decorated throughout with festive dames O. H. Hartley, J. A. M ill- greens, red berries and re d 'e r, Sid Smith and Mis3 Tatum, 'candles. The dining table was Fifteen Christmas , stockings over.'aid with a linen cut w ork w ere filled with fruit's, nuts and cloth and was centered by a cry- candles for shut-in .filks in the stal bow l of rod carnations, w hite com m unity. The club m em bers ex- statis and fern, flanked by red changed gifts. ; candles in cryntal holders. j „ , 5 V. I Mr, and Mrs. Apperson served Covers w ere laid for: Mr. and Christmas ‘ refreshm ents _to M es- Mrs. Caudell, T. I. C audell,’ Mr. dames Foy Cope, J. D. Hodges, and Mrs. Bill H oward, Mr. and ■ Grant Stephens, Sid Smith, B. W . Mrs. Sam H ow ard and daughter,' Singleton, W . R. Davis, Jj P. Jane; Mr. and Mrs. Bill Daniel Humphreys, J. A. M iller, J. L. and daughter, M argaret A nr Smith, H enry Shoaf, V. L. Call and Mrs. Sheek B ow den and I and' Miss Annie Pearl Tatum. daughter, Linda and Mr. and Mrs. and party at-the Fellow ship build­ ing o f the church on Friday even­ ing. A s tho group gathered they idund their places in a sem i-circle before the open fireplace with blazing yule-logs. Mrs. Otis H endrix opened the program : with an appropriate Christm as'devotional after which M iss Janie M arlin gave a short talk on Christmas customs in our country and in other countries. • Short business sessions w ere held separately' by the circles w ith Mrs. J. W . R odw ell and Mrs. L eo W illiam s, circle chairm en, in charge. A fter adjournm ent the group enjoyed a delightful buffet repast. Tho serving table was attract­ ively decorated with the Christ­ m as m otif featuring a red table cloth, and candle Clogs' covered w ith pine sprays. . — The exchange of . gifts by each m em ber was a highligh at the conclusion of the meeting. Kine-Sloari ' , Vows Spoken Mis'? ' Shirley D elyte Sloan, daughter of Mrsl D arrell Sloan of W alter Caudell o f Charlotte. Jerusalem H. D. Club Holds Meeting. ••: The annual Christmas Party of, Lexington, Route 3, and the late the Jerusalem Hom e Dem onstra-j Mr. . Sloan, becam e the bride of ‘ion Club w as held at/ the: hortie i James H. King, son of Frank King of Mrs G eorge Apperson, Friday, j of A dvance, Route 1, and the late Dec. 18. A Christmas program was j Mrs., K ing, at 5 p.m, Saturday at given by Mrs. F oy Cope, Mrs. Sid | the hom e of the Rev. G eorge B ru­ ner, Advance, Rt. 1. •The Rev. Mr. Bruner perform ­ ed the cerem ony. Mrs. K ing attended Clem m ons High School and is em ployed by S iceloff’s at Lexington. Mr. King attended Farm ington High school and spent tw o years in the Arm y. He is em ployed, by Hanes Dye and Finishing Co., at W inston- Salem. Colored News Davie Savings Club The Com m unity Savings Club of Davie County m et at the Shi­ loh Baptist Church parsonage M onday and received savings am ounting to $249.75. The m eeting M onday 'night clim axed four years for the Sav­ ings Club; The officers of the club are as follow s: President, Mrs. G. W. Cam pbell; vice president, Mrs. Linda A llison; recording secre­ tary, Mrs. A delaide E. Ellis; fin­ ancial secretary,. Mrs. Sereca M a­ son;- and treasurer, Mrs. Nora G orrell. Mrs. A lva C raw ford is chairm an of tne program com m it­ tee. MILM1D .NMfltlS C ollectors C u ff L in k s an d T ie B a rs ■ TUESDAY, DECEMBER 22,1953 by P io n e e r. Your Choice of 4 Different Models THE CUFF LINKS 3.50 THE TIE BAR 2.50 The Set . . . 6.00 Plus Tax BROS. . Club Lounge PAJAMAS - ' ; ■ ' Bx , ’ " V Weldon Pleated Slack-Type Trousers and Sport Shirt Topper . . . Make a combination for real comfort. This is a gift a man would choose for himself! 7-50 f°R TOUEl^ ARTICLES AND TRAVEL NEEDS * A natural question for youngsters watching tower­ ing giants of steel rise six to. the mile across the rolling terrain 'of the Piedmont.. . . / • They are witnessing completion of a big and a significant job—construction of the first 230,000-volt transmission line in the South. A super highway forelectric service, capable oftransmitting five times as much Electric Energy as present. 100,000-volt lines. \ T h is h ig h v o lt a g e t r a n s m is s io n lin e is b u ilt to s e r v e t h e ir g e n e r a tio n . Industry has enormous requirements now and for the future. Farm use has a big part in that estimate, too. Every year Piedmont farmers use increasing amounts of depend- . able, profit-making, low-wage Electric Help. - •- Advanced, transmission facilities play a vital part in our over-all system expansion in order to meet your electric service requirements. :"V. * ’ f t * C b r t o t m * * S -T -R -E -T -C -H 1 r i 1.00 By > 221 S. M A IN ST. FREE P A R K IN G IN R E A R ‘ U t g r * TUESDAY, DECEMBER 22,1953 THE MOCKSVILLE (N. C.) ENTERPRISE PAGE SEVEN W . V . ’ .V .V .V V .'.V .V .’ .V .V .V .W A V V .W .'.W .'.V V V .W .V ^ X 5 M g W i H l s / O < f i w .V .W i V .V .’ .V .V .V .V .V .V .V .V .’ .V .W .V .V .V .V .V .V .V Mrs. 0. K. Pope left on Tuesday | ston-Sa’ em and Miss Marie for Bristol, Tonn., to visit her Johnson of M orohead, K y. daughter, Mrs. V ick Obenshain.i A 4-C Bill Lookabill arrived Jack Pennington spent Tues-, M onday from Francis E. W arren day and W ednesday visiting his i A ir Force Base, W yom ing, to vis- m other, Mrs. W . M. Pennington, it his parent',, Mr. and Mrs. Ned In Asheville. Lookabill, until Jan. 1, M r, and Mrs. Bob A llred spent Mr. and Mrs. Lew is H. Cotton- Saturday visiting in High Point, girn o f Atlanta, Ga., w ill be the T hey plan to leave W ednesday for Christmas guests of their daugh- R obbins to .visit Mrs.. A llred’s ter, Mrs. Paul H .Richards, and m other and also plan to visit Mr. Rev. Richards. A llred’s parents in High Point I Lt. and Mr-,. E. C. LeGrand and before returning to their hom e!son, Eddie, w ill return to.A lbany, here. j Ga., Dec> 27> after spending the Mrs. E. W. Crow and Miss Jane | past tw o w eeks w ith his mother, C row arrived on Saturday from W ashington. Mrs. C row has been visiting her daughter there for about a month. Miss W illie M iller w ill leave on Thursday for M ooresville to ■visit her sister, Mrs. P rice Sherr­ ill, over the holiday w eek end. D ave Stilwell and Ed Short at­ tended a District B oy Scout com ­ m ittee m eeting in L exington last Thursday night. Mrs. Frank Clement, Mrs. E. W . C row and M iss Jane C row w ill spend the Christmas holidays w ith Dr. and Mrs. V ance K en­ drick in Charlotte. , , Miss H elen A vett of W ashing­ ton, D. C., is spending her vaca­ tion with her parents, Rev. and M rs. E. M. Avett; Mrs. W illiam A. Stroud, Jr., ac- Mrs. M argaret A . LeGrand, and brother, Jack A. LeGrand. j Mrs. J. T .’ Baity w ho has been ill at her hom e here for several m onths has been brighter the past week. ' A 3-C Charles E. Haire, w ho is stationed at L ow ry A ir Base, Denver, Colo., arrived Sunday to visit his parents, Mr. and Mrs. J. S. Haire, until Jan. 1. ! Mrs. J. P. Newm an is confined to her hom e in W inston-Salem be­ cause o f illness. | Mr. and Mrs.. Otis H endricks and sons, Johnny and M ickey, and Mr. and Mrs. J. W. Jones w ill leave Friday for Fort W ork, T ex-, as, to vacation for ten days. j Mr. and Mrs. R. S. Spear and children, G w en and Karen, of Durham w ill arrive Dec. 24 to com panied M rs.-W illiam A. Stroud spend the Christmas holidays with o f K inston to Augusta, Ga., la st. her parents, Mr. and Mrs. Craig w eek end to visit Pvt. Stroud who is stationed at Cam p Gordon. M r. and Mrs. B ob Hall and chil­ d ren w ill leave Christmas Day for D unn to visit her parents for the w eek end.,. M r .and Mrs. D avid Pope of W aycross, Ga., spent the w eek end with her parents, Mr. and M rs. L. S. Bow les on Route 1. H oliday guests of M r. and Mrs. P . J. Johnson and Miss Ossie A llison w ill be: Mr. and Mrs. W . A . A llison o f Charlotte, Mr. and Mrs. M. G. A llison and sons, ■William and M orris, o f W ilm ing­ ton; Miss Phyllis Johnson of W in- Foster. Mr. and/ Mrs. B. C. Clem ent and Miss A nne Clem ent return­ ed to Lexington, K y., Saturday. They w ill return Friday for a visit. Dr. Bill Sanford of Baltim ore, Md., arrived Tuesday to visit his m other -,Mrs. J. C. Sanford. Mr. and Mrs. Peter Leary and chil­ dren, Steve and Pamela, w ill ar­ rive Dec. 28 from W ashington, D C., to spend a w eek w ith her mother. M r. and Mrs. E. P. Ellis w ill spend Christmas w eek in Miami Beach, Fla., w ith ‘ his parents. | C. J. Angell Jeweler 3)3t3l3l3l3l3i3l3iaiS)S)Sl3i3iaiSl3t3l3i3lS)3)3l3lSl3l3)Sl9i3t3l3)3i3lSl3lSiai3l3lS)ai>l3l3)3l>l^ SP s? s? » Sf 5? « S? u5?a » s? st w .¥ S? 8? s? s? i % %11 l% % £ S I 3 II $ I I 1 J j t v g i i t s Famous Make S IL V E R P L A T E $49.95 Sheaffer’s P EN & P E N C IL S E T $7.26 up Ronson Lighter $5.50 Diamond Bridal Set $49.50 up Leather Billfolds $2.50 up Costume Jewelry $1.00 up Electric Shavers | Modern wrist Watches Schick, Remington, $ at old fashioned prices. Sunbeam | $22.50 up $19.95 up JS w%ieteK'tetsteie>steieiets!eieie‘e%ie<etete>eteieie>etet£<e!e>cte;>e‘eteiEieieieieieietctsie%iste They w ill then go to Johnson City, Tenn., to train in the M em orial Hospital until A pril 1, w hen they w ill return to W inston-Salem . Jack LeG rand arrived Satur­ day from Bainbridge, Md., to viiit his parents, Mr. and Mrs. J. P. LcG rand. Miss Clara B elle Le- Grand of W inston-Salem , w ill ar­ rive on Dec. 24 to spend Christ­ mas Day. M isn, Betty G ordon returned to Spray M onday after spending sev­ eral days here with Mrs. J. C. Sanford. H o’ iday guests of Mrs. M. D. B row n w ill be M r. and Mrs. Perry Ashe, Mr. and M r1;. Frank M c­ M illan and Mr. and Mrs. John Ranclce .and son, John, Jr., of Lum berton. Dr. and Mrs. R. F. K em p w ill leave Friday to visit her sister, Mrs. Don Briggs and M r. Briggs in Petersburg, Va., until Sunday. Mr. and Mrs. Fletcher Click anl M iss Jane C lick attended a dinner in Salisbury Sunday given at the hom e of his sinter, Mrs. A. B. Ram sey, and M r. Ram sey, for their m other, Mrs. W . G. Click, on her 89th birthday, anniver­ sary. Mr. and Mrs. Paul B lackw elder and daughter, Louise, w ill spend Thursday,, and Friday in Char­ lotte, th e' guerts of her m other, Mrs. E. P. B radley and her sister, Mrs. G eorge K uykendall and Mr. Kuykendall. Cpl. Law rence R ay Carter ar­ rived S atu rd ay'from Fort M on­ m outh, N. J., to spend the w eek end with his parents Mr. and Mrs. Hasten Carter. Their daughter, Mrs. C. B. Elam, Jr., of Thom as­ ville, w ill arrive Thursday. Misses Jo Cooley, Frances Stone­ street, Vasta Cope, Bill Collette and A llen Phillips attended a Y ule party Sunday afternoon in Concord, given by the N orth Car­ olina Paraplegic Chapter and the C abarrus' County P olio Chapter for Crippled Children and adults. Dr. R. P. A nderson is confined to his hom e because of illness. Mr. and Mrs. V ictor A ndrew s of Baltim ore, Md., w ill arrive Thursday to spend the w eek with her parents, Mr. and Mrs. W . W . Smjth. .. Mr. and Mrs. David M urray o f M orehead City w ill arrive W ed­ nesday to visit M r. and Mrs. E. C. M orris. Miss D orolhy M orris, student at Salem College, arrived last Thursday to spend her va­ cation w ith her parents. This group with M rs. E. H. M orris w ill <;pend Christmas Day in High Point with M r. anl M rs. H orace Haworth. Mr. and Mrs. Paul Sau- nier of W ashington, D. C., w ill arrive on Saturday to visit the E. C. M orris’. Mr. and Mrs. Ed Short and chil- Iren w ill leave on Thursday to spend the holidays w ith'' her father in High Point. T hey w ill also visit his parents in G room e- tovvn. M r. and Mrs. D. J. M ando and children w ill spend Christmas day w ith her parents in Rural Hall. Pvt. and Mrs. Jack Pennington arrived last w eek from W ashing­ ton, D. C., to spend ten days va­ cation with her parents, Mr. and Mrs. J. K. Sheek. Sgt. G eorge Foster arrived last w eek from overseas duty with the A rm y in Austria. His brother- in-law, R obert Hendricks, w ill drive to W ashington, D. C., to bring him hom e for the holidays to visit his m other, Mrs. M. G. Foster. T hey w ill be accom panied by M r. and Mrs. M. G. Foster, Jr., of W ashington, w ho w ill visit here, too. Mr. and Mrs. D. W . Casey of Jacksonville, Fla., and Mr. and Mrs. J. W . D ickerson of South­ ern Pines will- arrive on Thurs­ day to spend the holidays with Mrs. J. W . H odwell, Sr. Visitors expected for over the week end by Mr. and Mrs. M arvin W aters include Mr. and Mrs. Paul H ockett and children of Greens­ boro, Mrs. W. P. A m os and son, of Asheboro, M r. and Mrs. J. D. Potts and son of High Point; and Miss Ivey Nail of H ickory. M r. and Mrs. Jim W hite of Chapel Hill, and Jack W ard, of Salisbury, w ill arrive on Thurs­ day to spend the holidays with Mr .and Mrs. Grady W ard, Cana H.D. Club Holds Meeting The Cana H om e Dem onstration Club entertained the Pino-Farm ­ ington Club Thursday evening at a Christmas party which was held in the com m unity building. The m eeting \vas called to or­ der by the president, Mrs. W ade Groce. The group sang a song, “ Com e A ll Y e Faithful.” D evotionals w ere given by Mrs. E. F. Etchison which consisted of reading the Christmas Story. This Betty Carleen Angell, Georee Alton Carter Wed In Home Rites Miss Betty Carleen Angell, daughter of Mr. and Mrs. Cash- w ell Jones Angell, becam e the bride of G eorge A lton Carter, son of Mrs. T. W . Carter, al 8 p.m. Tuesday, D ecem ber 22, at hei hom e on Salisbury Street. The Rev. J. P. Davis, pastor of the First Baptist Church, per­ form ed the cerem ony. The hom o was decorated with red poinsetti- as and w hite candles. The bride, given in m arriage by her father, w ore a street- lengtli dress of white velvet with m uskrat trim and a brow n velvet cloche. She carried a white pray­ er book topped with a w hite or­ chid. I Miss Janie Cozart, pianist, and Misses Lena Cornatzer, Helen Poston and Carol M iller, vocal­ ists, gave a program of w edding music. ! Miss Hazel Clement, cousin of the bride, was maid of honor and S. W . Brow n, Jr., was the groom ’s best man. | Follow ing the cerem ony a r e -1 ception was held for m em bers of the im m ediate fam ilies and c’ ose friends. A fter a w edding trip, the couple will live with the bride’s parents on Salisbury St. F or trav­ el the bride w ore.a grey flannel suit, grey lizzard shoes and a place blue blouse and the orchid from her prayer book. Mrs. Carter is a senior at the M ocksville High School and plans to graduate w ith her class in May. Mr. Carter is em ployed at S. W. Bro\yn and Son W holesale G rocery Company. The m other o f the bride w ore a black crepe dress w ith blue lace trim and the m other of the groom was attired in purple crepe, and lace.* Both m others w ore w hite carnations in corsage. Mr. and Mrs. Sanford Have Bridge Party M r. and Mrs. J. S. Sanford en­ tertained at a bridge party Sat­ urday evening at their hom e on South M ain Street. ' Christmas red gladioli, m agno­ lia foliage, berries and red candles decorated the room s for four tables of bridge. The m antle held white reindeers and glow ing white and red candles. Mrs. L. G. Sanford com piled ihe highest score ior ladies and H arry Osborne w on the m en’s award. J. S. B rasw ell w as w inner in bingo. - • A fter the cards w ere laid aside parfait, coconut cake, coffee and nuts w ere served to:, Mr. and Mrs. A. M. K im brough, Jr., Mr. and Mrs. Harry Osborne, Lt. and Mrs. E. C. LeGrand, Mr. and Mrs. G. N. W ard, M r and M rs L. G. San­ ford, Mr. and Mrs! J. S. Braswell, M r and Mrs. John Durham and Jack W ard. IT PAY’ S TO ADVERTISE PrinccssTlieatre Thur. & Fri.: “ M A RR V ME AGATN" with M arie W ilson. Cartoon and News. Sat.: “ SA V A G E FRON TIER” R ocky Lane. Cartoon & Serial. M on. & Tucs.: “ LA W AN D OR­ DER” Technicolor. Ronald R ea­ gan. Cartoon and News. W ed.: “ IT H APPEN S EVERY TH U R SD A Y.” Loretta Young. Cartoon and Com edy. Phone 182 for Show Tim e KM Seats Theatei YAD K IN VILLE , N. C. was follow ed by a prayer. The roll call was answered by “ W hat Christmas m eant to m e as a child.” Mrs. Duke P ope read a poem, “Let Us K eep Christmas.” “ This Is Christmas,” was given by M iss M ackie. The Club collect was given and the m eeting adjourned with the ringing o f one verse of “ Silent Night.” D uring the social hour gifts w ere exchanged, games w ere played, and refreshm ents w ere served by Mrs. W ade Groce. Thursday, Decem ber 24 “Plunder of the Sun” with Glenn Ford, Diana Lynn and Patricia M edina Friday, D ecem ber 25 — A Great Big Christmas Show — “ROM AN H O LID A Y ” with G regory Peck & A udrey Hepburn. A lso selected short subjects Saturday, Decem ber 26 “A R R O W H EA D ” In T echnicolor with Charlton Hes­ ton, Katy Jurado & Jack Parlance. A lso Charles Starrett in ‘The Hawk of Wild River’ A nd selected short subjects Sunday & M onday, ,Dec. 27 & 28 “D E V IL ’S CA N YO N ” IN 3-D and in co’or w ith Virginia M ayo and Dale Robertson Tuesday & W ednesday, Dec. 29-30 “Ambush At Tomahawk Gap” with John flodiak SU N D AY M OVIES Shows at 1:30 3:00 9:00 Doors Open I p.m. and 8:30 p.m im ffiii1" BIG 15-INCH ONEIDA SILVER-PLATED TRAY YOUR SPECIAL GIFT! Am azing offer — act fasti Get 2 wonderful Christmas gifts for the price of 1! You must see this big, exquisite, heavily silver-plated tray to appreciate it! It's yours, at no extra cost, when you buy the sensational new LEWYT now —the vacuum cleaner with NO DUST BAG TO EMPTY! R A YTH EO N - DUM ONT T E L E K IN G As low as $169.95 \ KELVIN ATOR Refrigerators, Stoves M AYTA G Washers G EN ER A L M ILLS and U N IV ER SA L S M A LL A P P LIA N C ES The W orld’s FIRST and ONLY COMPI.ETF.LY AUTOMATIC Sewing M achine v Ho dustbin ■ , LC VI I I VACUUM CLEANER *125 a w««lrl R O B O T A N D W E H A V E A P P L E S , T O O ! Among the many North Carolina farm items enjoying steady production increases is the rarely mentioned apple crop. A record 2 million bushels were grown and sold in 1952I In view of the important part this cash crop plays in Tar Heel farm income, it goes far in making our state a better place in which to work, play and live. Another contributing factor to more pleasant living for North Carolinians is the brewing industry's self­ regulation program where brewers, wholesalers and retailers—in counties where malt beverage sales ore permitted under State control — cooperate to main­ tain wholesome conditions for the legal sale o f beer and ale. North Carolina Division UNITED STATES BREWERS FOUNDATION, INC. % % % ■ m "M|i- %■ ■*’ The sewing machine with a mechanical brain. Sews every wanted stitch automatically by a simple f)(ck oi a lever - NO DIALS TO MOVE - NO ATTACHMENTS NEEDED/ SO S IM P L E . . . E V E N A C H IL D C A N A C T U A L L Y S E W A N D C H A N G E D E S IG N S W H IL E C O M P L E T E L Y i i l i n d f o l d e d : You too, can sew on the machine o f tomorrow — TODAY I ZIG -ZA G M A CH IN ES as low as ...................................... $219,95 C. J. Angell Appliance Co. Phone 60 I On The Square jj 8 PAGE EIGHT UESI)AY, DECEMBER 22,1953 N O W S H O W I N G ............................... •- 1 ■■'■■■■ ...................— 1 "■ ■— ■ ° , Worlds Safest and Most Advanced-Styled Car 1 9 5 4 S T U D E B A K E R B IMPROVED "MIRACLE-RIDE"! © MOST POWERFUL . BRAKES? ; WORLD'S FINEST V ¥ ENGINE @ NEW COLORS! ®'NEW'STYLED'■ ; INTERIORS! © STAND-OUT ' ECONOMY! • STAND-UP DURABILITY! 1954 SPORTS CAR PACES STUDEBAKER STYLING• A • NEW COLOR INTERIORS ; . to harmonize with exteriors! » • Finest AUTOMATIC DRIVE featuring • ANTI-CREEP • HILL HOLDER ■ • Hero is Studcbakcr’s brand new sports car for 1954, thc Commander Starliner Hard-top. The low, wind-swept lines that have won national and international honors arc accentuated by new grille and bumper treatment. Interiors are as exciting as thc style pace-setting lines of the car, with appoint­ ments ahd upholstery harmonizing with thc 12 solid and 10 two-tone combinations in which tho model is availublc. The Starliner is also available in thc Champion series. STUDEBAKER OFFICIALS VIEW NEW CONESTOGA STATION WAGON & I f f e ' m, -,±i Harold S. Vuucc (right), president of'I he Studebaker Corporation, aiul I’nul C. Hoffman, Cliair- man of the Board* were'in a rcflectivc mood as they stood beside thc CONhSIOGA, Studcbakcr’s brand new, all-steel station wagon for 1954. Designed for "people who go places**, thc car waa named for thc original Conestoga wagon in* which the founding brothers of Studebaker travelled to South Bend, Ind., from Ohio more than 100 years ago. Like thc new sports models and sedans, the CONESTOGA was designed for Studebaker by internationally famous Raymond L*»ewy. It is avail­ able in both the popular Champion and Commander V-8 series in eight solid and five two-ton® "*'lor combinations with harmonizing vinyl interior trim. • AMAZING ECONOMY! • FAMOUS OVERDRIVE TRANSMISSION! © STAND-OUT SAFETY — WORLD'S SAFEST CAR! 4 * - * / ©ALL-AROUND VISION! » ... • BRAND NEW ALL-STEEL STATION WAGON! THEY’RE THE BEST AUTOMOBILES TO BEAR STUDEBAKER NAME The Champions and the Commanders for 1954 ave the best automobiles ever to bear the Studebaker name. They are best in appearance—unques­tionably the most modern designs on the roadways of tho .'world. They are best in Interior beauty—with luxurious new color-styled two-tone in­teriors in perfect harmony with exterior colors, They are best In safety—with their lower center of gravity, greatly Improved vision and bigger, more powerful brakes. They are best in economy—because more than in any other car, unnecessary weight has been eliminated. And the champion and Commander engines are famed for their gas-saving economy. They are best in comfort, ease of han­ dling and roadability qualities easily proven by demonstration, In short, the Studebaker cars for 1954 are the best all-around values offered to the public by anyone anywhere. STUDEBAKER’S NEW 1954 CHAMPION SEDAN A smartly styled chrome rub rail extending from the tail lights to the forward edge of the front doors gives added protection and accentuates the flowing lines of thc Regal Champion four-door ■edan in the 1954 Studebaker line. The car is available in 12 solid and 10 optional two-tone color combinations with interiors carried out in an exciting new blending of fabrics and appointments. A Demonstration Is All We Ask—Then Compare! • POWER STEERING! • ECONOMICAL IN PRICE • ALL STEEL BODIES! » H E D R I C K A U T O C O . , I n c . Your Siudefeaker Dealer 120 -N. Church St.Salisbury Phone 14 TUESDAY, DECEMBER 22,1953 THE MOCKSVILLE (N. C.) ENTERPRISE PAGE NINE M r. and Mrs. M illard A lexander o f Kanapolis visited Mr. and Mrs. C. C. liconard and fam ily Satur- ■ day. M r. O. G. M cClam rock and fam ­ ily visited relatives in Kannap- • olis Sunday. A . group from Oak Grpve visit­ ed the county hom e Sunday af-j - ternoon. They took gifts and sang. Christmas carols. M r. and Mrs. K nox W hitaker’ have a new baby girl w hich was ' born Saturday m orning. j M rs. Cecil Leonard, and daugh-j ters, Dora and Ella Mae, visited relatives and friends in Kannap­ olis Sunday. They w ere dinner guests o f Mr. and Mrs. W . O. Dearm an and fam ily and attend­ ed a Christmas cantata at M id­ w ay " M ethodist Church Sunday* night. I Mr. and Mrs. R. L. W hitaker, Jr.j have a new Chevrolet car. | The Junior girls Sunday school! class had a Christmas party at I the com m unity building Friday night. *■» ffhe Junior boys Sunday school class had a Christmas party at the com m unity building Thurs­ day night. The ladies Sunday school class had a Christmas party at the hom e of the teacher, Mrs. Boger, Satur­ day night. Miss Bonnie A tw ood attended the Christmas party at Draughn’s Business College W ednesday night. She also sang in a quartet that was given. The Christmas program w ill be given at Oak G rove Thursday night, Dec. 24, at 7o’clock. W illis W hitaker, J. C. Leonard and Miss Dora Leonard attended the Thom as and H ow ard and Snider W hole Com pany’s annual Christmas banquet Saturday, Dec. 19, held at the Y adkin H otel in Salisbury. The W . S. C. S. w ill have a N ew Year’s party at .the com m un­ ity building Saturday night, Jan. 2. The M. Y. F. w ill have a w atch night service on Dec. 31. 1 £It’s Back Again SPECIAL I Q U A R T \ ■ ' jj At Your Favorite S E A L T E S T Dealer S ' 'g or order from your Distributor: I Twin Brook Farm | Phone 94 Mocksville, N. C. fe»«mwtmtmcig!C!g!titsg:g»«:igigtg!t;gic«KiEigi8itigcnigign;tgigtgtg;cie!«tt!gigigii “L E T GOD B E T R U E ’ By PA U L SIKES One of the sactdc'-.t expressions in the B ible is that “ God gave them up.” G od does not like to see his people reject Him. God will never give up any until they are t.ir-’ d of lining with Him. W e read that he did give up som e w ho refused to com e in the w ay as directed bv G od.'"W herefore God also gave them up to uncleanness through the lusts of their ow n hearts, to dishonour their ow n bodies . betw een them selves." “ For this cau'-e God gave them up unto vile affections: for even thpir w om en did change the nat­ ural use into that which is against nature.” ; "A nd even as they did not like to retain G od .in their know ledge, G od cave them over to a reprobate mind, to do those ♦bn’es w hich are not conven­ ient.” ( Rom . 1:24, 26, 28). This was very m uch like the conditions bpfnre the flood. “ A nd G od saw that the w ickedness of man was great in the enrth, and that everv im agination of the thoughts of his heart was only evil continual­ ly.1’ (G en. 6:5). Could it be that w e w ill let the cares o f this w orld and the love of riches and pleasure cause G od to give up? Sam uel in the long ago felt that the peo- ole had rejected him . H ow ever, God knew that they had reject­ ed God. "... they have rejected me, that I should not reign over them.” (I Sam. 8:7). Jesus expressed his desire that man w ould com e to Him. "O Jerusalem, Jerusalem , thou that killest the prophets, and stonest them w hich are sent unto three, how often w ould I have gathered f.hy children together, even as a hen gathered her chickens un­ der her w ings ,and ye w ould not.” (M att. 23:37). Peter expresses G od’s w ill. ‘T h e L ord . . . is longsuffering to us-ward, not w ill- 'ng that any should perish, but that all should com e to repent­ ance.” (II Pet. 3:9). T o be sen­ tenced' to “the lake w hich burn- eth with fire and brim stone: which is the second death,” w ill be the eternal fate of those w hom God rejects unless they repent. W e all need to seek the Lord, “ . . . though he be not far from everyone of us.” (A cts 17:27). H ow ever w# must seek Him in His ow n appointed way. The L ord’s book teaches us to believe, to con­ fess, to repent, and to be baptized for the rem ission of sins. Then w e are to live a life of faithful ser­ vice. Let us so live that G od w ill not give us up. adv. THE CHURCH OF CHRIST W hich M eets at Jerichoi _____ > W. B. LeG rand is confined to his hom e on Salisbury Street with illness. Mrs. G. W . M cC lam rock has been quite sick the past week. • Seasonal Close-Out Sale of Wheel Goods T A Y L O R T O T S T R O L L E R .......................................................................$ 1 0 .9 5 M U R R A Y T O Y A U T O ..................................................................................$ 1 3 .5 0 M U R R A Y F I R E T R U C K .......................................... ...............................$ 1 7 .9 5 M U R R A Y D U M P T R U C K .........................................................................$ 1 8 .9 5 R A D I O T O W N & C O U N T R Y W A G O N .:...................................$ 1 5 .9 5 R A D I O F L Y E R W A G O N ( I n C a r t o n ) ........................................$ 8 .0 0 R A D I O S U P E R W A G O N ( I n C a r t o n ) .............................................$ 5 .0 0 M U R R A Y T R A C T O R ........................................................................................$ 2 6 .9 5 1 0 I N C H J U N I O R T R I C Y C L E .................................................................$ 8 .9 5 1 2 I N C H J U N I O R T R I C Y C L E .................................................................$ 1 0 .8 5 1 0 I N C H J U N I O R T R I C Y C L E ................................................................$ 6 .9 5 P E D A L W A G O N ....................................................................................................$ 1 0 .0 0 Y O U W I L L F I N D M A N Y B A R G A I N S I N . . . H A R D W A R E — H O U S E W A R E S — P A I N T S — F I S H ­ I N G T A C K L E — B U I L D I N G M A T E R I A L S ■— A T — Miller - Evans Hardware Co. — A t I n t e r s e c t io n o f Y a d k in v ille a n d S t a t e s v ille H ig h w a y s — P h o n e 6 5 W ilk e s b o r o S t. M o c k s v ille , N . C . n P H ILCO T ELEV IS IO N — Sales and Service— Hendricks - Merrell Furniture Company Salisbury St.M ocksville JEWELRY AND E X P E R T W A TCH R EP A IR IN G FO ST'ER’S W A TCH SHOP “O U T FIT T ER S to M EN ’' T R E X L E R BROS., Inc. SALISBU RY, N. C. Manufacturers of Ladies’s Pajamas M O N LEIG H G A RM EN T CO. 9:00-i';lB9:4510:0011:3012:0012:1512:3012:451:302:002:303:00 3:304:004:004:305:003:005:155-30 0:00 0:156:300:457:00 . 7:15 7:30 7:45 8:30 9:00 0:30 10:00 10:30 11-no 1:45 9:159:3010-00U:00 12:0012:0012:1512:3012:451:00 1:301:302:002:002:302:553:00 4:00 5:15 6:156:306:45 WSJS WINSTON-SALEM CHANNEL 12 TH URSDAY - 3—HI Buy That 3-—-Morning Show 3—Guiding Light 3—Arthur Godfrey 3—Strike It Rich 3—Valiant Lndy 3—Love Of Life 3—Search- For Tomorrow •3—Cnrolinn Cookery 3—-Gnrry Moore j 3—Betty Feeder Show 3—Art Llnklettcr *3—Nancy Carter Show 12—Kate Smith 3—Bob Crosby 3—Arthur Smith 12—Welcome Travelers 3—12—On Your Account 3—Cartoon Carnival 12—White House Christmas Tree 3—S*ory Painter 3—Lone Ranger 12—Fowdy DnnHv 3—Shop by TV 12—Rounduo Time 3—Jane Fromnn 3—F«sso Reporter 3—Weather Report 3—Johnny’s Hobby House 12—Jnhnnv Comas Presents 3—Snin To Win 3—Doitfflas Edwards 12—Curt 7.. Pnccrs Show 3—Snln To Win 12—Camel Vows Caravan 3—Boston Blnckle 12—Ornucho Marx 3—T T -cad Three Lives.12—T-Mor* In Action 3—Lux Theatre 12—r>r*trr«*»t 3—nit! Town 12—Ford Theatre 3—Mop* Mr. McNutley 1?—Martin Kan«»3—Plne/» The Tare 12— Final—«i*nv off - 3— Chrl^T^ns Carol ?—MldntpM Mass—St. Patricks’ 3—Sign off FR ID A Y < ) 3—Christopher Show 3—A Star Shall Rise 3—Beyond Tomorrow 3-12—Washington Cathredral Christmas Service 3—Valiant Lady 12—The Joyful Hour 3—Love of Life 3—Search For, Tomorrow 3—A Christmas Tree Grows 3—Santa and Fairy Snow Queen12—A Star Shall Rise 3—Gary Moore 12—ThLs Is The Life 3—Double or Nothin?12—Christmas Film'> Features 3—Art Linklettor 12—News and Weather 3—Christmas Big Top 12—Kate Smith 3—Miracle on Main Street 12—Welcome Travelers 12—Atom Squad 12—Gnbbv Hayes 12—Howdy Dood,y 12—Roundun Time 3—Coke Time 3—Esso Reporter 3—Weatherman 12—News and weather 3—Anybody’s Guess 12—Johnny Coma* Present* 7:157:30 9:009:30 10:0010:0010:3010:45::wil:io11:1512:30 9:3010:0010:3011:0011:3012:001:002:oo2-303:oo5:005:00 • 6:00 6:30 7:007:007:30 8:00 , 8:30 9:009:oo 10:0010:30 11:00 ; 11:15 12:0012:301:001:302:00 4:30 5:005:005:306:006:30 7:00 7:30 8:009:00 9:3010:00 10:30 U:00 11:1572:15 YVETV CHARLOTTE CHANNEL 3 3—Do It Yourself 3—Dougins Edwards 12—Eddie Fisher 3—Perry Como 12—Camel News Caravan 3—Mama12—Garroway At Large 3—Topper 12—Life of Riley 12—Christmas Day with Ray 3—Mr. nnd Mrs. North 12—Boston Blnckic 3—National Theatre '32—Gillette Christmas Show 3—Pride of The Family 12—News Final (Slffn off)3—News And Sports 3—Weather Report 3—Late Show 3—Sign off SATU RD AY 3—Captain Video 3—Captain Midnight 3—Johnny Jupiter 3—Cisco Kid 3—Smiling Ed McConnell 3—Big Top 3—Western Feature 3—Big Picture 3—Talent Patrol 3—Pro Basketball 12—Sagebrush Theatre 3—Judge For Yourself 12—Film Feature 3—-Ramar of the Jungle 3-~Fireside Theatre 12—This is The Life 3—Burns and Allen 12—Pitdmont Playhouse 3—Beat The Clock 12—Armchair Playhouse 3—Jackie. Gleason 12—Amateur Hour 3—Foreign Intrigue 12—Excursion 12—Show of Shows 3—Ford Theatre 3—Four Star Playhouse 12—Hit Parade 3—Weeks News In Review 12—News Final (Sign Off)3—Wrestling SU N DAY 3—This Is The Life 3—Names The Same 3—Stu Erwin 3—Frontiers of Faith 3—Professional Football Play-off 12—Professional Football 3—Adventure 12—Film Feature 3—Omnibus 12—Triangle Theatre12—Youth Wants To Know13—Sunday Vespers »3—Harriet and Ozzie12—Kukla, Fran and Ollie 3—Life With Father 12—Winchell and Mahoney 3—Jack Benny 12—Mr. Peepers 3—12—Comedy Hour 3—Fred Waring 12—TV Playhouse 3—Man Behind The Badge 3-i-Who Said That 12—Letter To Lorettn • 3—What’s My Line 12—Man Against Crime 3—Sunday News Special 12—News Final Slgn-ofi 3—Toast of The Town 3—Sign oil General Electric —Sales and Service— ----------• ----------- D A N IEL Furniture & Electric Company A T OVERHEAD BRIDGE M OCKSVILLE, N. C. Laundry and Expert Dry Cleaning Mocksville Laundry & Dry Cleaners i DEPOT STREET T E L E - K IN G T E L E V IS IO N ; -Sales and Service— C. J. A N G E L L A P P LIA N C E CO. M OCKSVILLE, N. C. Ji. C. A. , W ESTIN G H O U SE — Sales and Service— • tD A V I E FU R N IT U R E CO. SOUTHERN RAILWAY SYSTEM WASHINGTON, D. C. PAGE TEN THE MOCKSVILLE (N. C.) ENTERPRISE TUESDAY, DECEMBER 22,1953:: CHRISTMAS JOY ^ k9i9l9i9t9l9tSlSlSl%3)3)Sl3iai5i9i3iaiSl9l9l9l9l3)Sl3l9l3l9)3)S)»lh»>lM9lSl»Sl>l>l>l3)»M9 i <*5 9 1 K sI 4 Corners We're happy to // Repeat Our (&’ Annual Wish: m . Happy Holiday. o l d l a * L l o n e J . 0 W 1 6h i t I• v / -------\ , « « « I xic«ic>ciKiCi(!eiC!C‘e «««> («‘e>c>e><icieieieis>c«ie«isic«teie«i(>c<aic<c>eieieiC!etctc<( G. N. Ward MOCKSVILLE, N. C. i Fritts Packing Company g LEXINGTON, N. C. | i*<c»g*c<ctt»ltgt«tc»cgt0ggtg<«gyigtctgtctctgtgtgtgtgtgtctc*gtgtgtctctc*tctctt*ttgtt»ctc** mERHV CHRlSimRS Happiness Jack Mar.ten from Alexander scliools is here spending the holi­ days with his mother, Mrs. Rho­ desia Mastcn. Mrs. HenryL. Shore underwent dental surgery in Winston-Salem Friday. The W. M. S. of Couriney'Bap- tist Church met at Courtney at the school on Friday night. Mrs. Cletus Ratledge and Mrs. Dewey Dixon went shopping in Salisbury last ^Monday. Mr. anl Mrs. Baity Lowery spent Monday night as guests of her parents, Mr. and Mrs. Byrd Peele. A. C. Ratledge is spending a week’s vacation with his son and family, Mr. and Mrs, Douglas Rat­ ledge and daughter, Linda, at New Bern. Mr. and Mrs. Floyd Joyner of near Liberty spent a few days the past week with her daughter, Mrs. Leon Baity. Wess Lowery of Charlotte spent the past week end with George Baity and Mrs. R. L. Lowery. Mr. and Mrs. Leon Baity and Ronnie spent Tuesday in Win­ ston-Salem shopping. Edna Ann Shelton, Grady Beck and Mr. and Mrs. Edward Beck spent Saturday in Winston-Salem. Several around here attended the basketball game at Farming­ ton Friday night with Rockwell and Farmington. The crowning of the home coming queen, Miss Dorothy Reavis, took place at this event. Cornatzer This community was saddened to hear of the death of Jesse Nail He was found dead in bed Tues­ day moaning. He made his home with Mr. and Mrs.' Albert Bow­ ens. Barbara Potts has been on the sick list. i Mrs. Travis (Tysinger spent Thursday with Bertha- Carter. Mrs. Conrad' Dwiggins of Vir­ ginia came Wednesday for the funeral of Jesse Nail. . , IT PAYS TO ADVERTISE Miss Louise Stroud Is Hostess At Parties I Miss Louise Stroud entertained her music class at two Christmas' parties last week. On Thursday evening, ho entertained the young­ er group at the home of P. C. Grubbs on Spring St. Games and' contests were enjoyed by the class, after which refreshments were served. Climaxing thoi evening’s entertainment was the; exchange of gifts around the, Christmas tree. Pupils present j w ere:-Ann Foster, Barbara A nn1 Smoot, Connie Dell Wagner, Bar- j bara and Kay Chapman, Jackie Dull, Kay Lanier, Rachel Bowie-., j Ophelia Keller, Melva Jean Car-i ter, Linda Sherrill, Mary Ann] Glasscock, Jane Rowland, Robert Rowland, Johnny York, Dwain Furches, Larry Hendricks, Jim­ mie Tutterow and P. C. Grubbs, Jr. Additional guests wore Mr. and Mi’s. P. C. Grubbs, Nancy Grubbs and Jessie L, Stroud. On Friday evening, Miss Stroud entertained the second group at the home of Jackie Dull on Salis­ bury St. Games and contests were enjoyed .after which refreshments were served to the following pu­ pils: Sylvia and Linda Stroud, June Greene, Dianne Smith, Lin­ da Hartley, Linda Hendricks, Gaye Rice, Edith Ann and Elaine. Smith, Gail Jones,’ Sue Cartner, Peggy Wall, Marilyn Spencer,' Gail Hendrix, Jackie Dull and Bill Collette. Mr. and Mrs. Wade Dull, Ronnie and Gerry, and Jessie L. Stroud were gljests. , HONOR ROLL • The honor roll for the fall term at Appalachian State Teachers College has just been released by the Registrar, H. R. Eggers. In­ cluded in this ^list of distinction are the following from Davie County: Clara Lee Brown, Mar­ garet Cozart and Nancy Jean La­ tham, all of Mocksville and Ruby Jean Potts, Advance. MAKES DEAN’S LIST 1 Cadet D. R. Barnhardt of A d­ vance, has been placed on the Dean’s list for the second grad­ ing period at Oak Ridge Military Institute. The Dean’s list is com­ piled by an academic average of B or better on all subjects taken. This is cadet Bamhardt’e first year at Oak Ridge. CHRISTMAS GREETINGS FROM THE PUBLISHER 1 The Mocksville Enterprise .MOCKSVILLE, N. C. Peace and Contentment be Yours W. G. White Company WINSTON-SALEM, N. C. TUESDAY, DECEMBER 22,1953 PAGE ELEVEN “W O R K W AN TED —'Young m arried man desires w ork on dniry farm . Contact D avid J. Jarvis, Rt. 2, M ocksviU c. W O M EN W AN TED —H ousew ives address advertising post cards. M ust have Rood handw riting. U N D O , W atertow n, M ass. 12 17 4tp F O R SALE— pair o f good m ules, 5 and 8 years old. One 11 year old m arc, one M cC orm ick - D eering riding culti­ vator .and other farm ing tools. A bar­ gain to quick buyer. See G. F. Forrest, A dvance, Rt. 1. 12 17 2tp Vi PRICE SALE I W AN TED — H ave yo* r p rescrip tion s1 filled at H A LL D R jG CO M PAN Y. I P hone 141, M ocksville. tfn | O E N E R A L ELECTRICAL CO NTRACTIN G and. Elc-clricul Scrvice. N. C. Licensed ■ Electrician and Contractor. REA CER* TIFIED CO N TRACTOR AN D D E A L ­ ER. RO D W ELL ELECTRIC CO M ­P A N Y , M ocksville, N. C. ;fn EX E C U TR IX NOTICE * N otice is hereby given that M ary L clio , H opkins has this day qualified as ex ec- I u trix o f the Last W ill and Testam ent o f A lice M artin H opkins, deceased, late o f the C ounty o f D avie and State of N orth Carolina. AU persons having claim s against said estate w ill present tcm . du ly verified, to M ary Lelia H op­ kins, at her hom e on M ocksville, Route 3, on or before the 2Gth day o f N ovem ­b er, 1054, or this noticc w ill be pleaded In bar o f their recovery. A ll persons in­ deb ted to said estate w ill please m ake Im m ediate settlem ent. 11 26 GtpT his the I9fh day o f N ovem ber, 1953. M A R Y L ELIA H O PK IN S, executrix of A L IC E M A R T IN H OPKIN S, deceased. EX E C U TR IX NOTICE N otice is hereby given that Florence 8 . Leonard has this day qualified as ex ecu trix o f the Last W ill and Testa­m en t o f W . A . Leonard, deceased, late o f the County of D avie and State of N orth Carolina. A ll persons having claim s against said estate w ill present them , d u ly verified, to F lorence S. Leonard, at h er hom e in A dvance, N. C., on or before D ecem ber 10. 1954, o r this noticc w ill b e pleaded in bar o f their recovery. A ll persons indebted to said estate w ill please m ake im m ediate settlem ent. This the 23rd day of O ctober, 1953. FLORENCE S. LEO N ARD. E xecutrix of W . A . Leonard, deceased. 12 10 6t AD M IN IST R A T O R ’S NOTICE N orth Carolina—D ovie County The undersigned, having qualified as adm inistrator o f the estate o f J. B. C ook.’ deceased, late o f D avie County, (h is Is to n otify all persons having claim s against said estate to present them to th e undersigned on or before thc 4th day o f D ecem ber, 1954, or this notice w ill tie pleuded in bar o f their recovery. AI1 persons indebted to said estate w ill please m ade im m ediate paym ent to thc undersigned. 12 3 Gtn T his the 1st day o f D eem ber, 1953. W . B. REN EG AR, Adm inistrator R . B. SAN FO RD , Jr., A ttorney. NOW . . , you con ga' TWO {regular $2.95 tach) VENIDA "Hang Over" Hangers, designed to conform to your everyday dressing habits—coat first then trousers— for the price of ONE . . .. PLUS a BONUS GIFT of a sturdy pair of canvas sole, terry cloth slippers! These beautiful hangers are made of durable cellulose plastic with an attractive walnut finish—an unusual life­ time convenience for men and women! Individually pack­ aged in a colorful picture box—an Meal gift! VENIDA MAKERS OF FAMOUS VENIDA HAIR NETS Venida Products 119 Weil 40th St., _________________________________New York 18, N. Y. Enctoied li my* cheek or money order for $2.93. Send me the 2 Venida "Hans Over" Hanoers PLUS your Special Bonus Gift of 1 Pair of Terry Cloth Slippers. Check Slipper Site Q (Small) Q (Medium) □ (Large) ^ NAME___________________________________________________ . ____________________ ADDRESS______________________________________________________________________________ PITY --ZONE,-STATE- A n n o u n c e m e Please do not bring in any mor until after Jan. 1st We have all handle between now and that time, close Dec. 24, 25 and 26, for the C F holidays. However, we do have sj: hogs, so bring in your hog meat, handle it right now. Only two nio» for dressing chickens— Dec. 10 and T We wish to thank all our frier customers for their cooperation and h business. We sincerely appreciate i* Davie Freezer L r Arthritis? I have been wonderfully bless­ ed in being restored to active life afier being crippled in nearly every joint in my body and with muscular soreness from head to foot. I had Rheumatoid Arthritis and other forms of Rheumatism, hands deformed and my ankles were set. Limited space prohibits telline you more here but if you will write me I will reply at once and tell you how I received this won­ derful relief. M RS. L E L A S. W IER 2805 Arbor Hills Drive P. O. Box 2G05 Jackson 7. Mississippi Desirable Proper! FOR S A 1 1 In and Near Cooker B ELO N G IN G TO ERW IN M IL L S 265 A C R E STO C K AND D A IR Y F Known as Cooper Place. Located about three miles from Cooleemee on C u o I c m .'- c 'Junction Road. Frontage en this paved highway of 2<ti' feet. About one-half of this land is in a high state of oulii- valion, 17 acres of which is now in alfalfa, about 28 acres in pasture, the remainder of cleared land is fine soil for the, growth of cotton, corn oats and wheat. improvements—2 story, 6 room farm house in fair con­ dition. . 1 5-room cottage in good condition. 1 barn,.i2 x 75 (two story barn), 1 small barn with slicds all around in good condition. Smoke house and woodshed. This entire tract is wel' watered being bounded by a good branch oil one side, Hunting Creek along entire back line with good highway frontage. School bus and mail route service to Coolemee. Reasonable price and good terms on above property. Did you Remember . . . . .. those last minute Christmas cards? If not, you can send tele­ grams to friends too far away for cards to reach them by Decem­ ber 25. Vou can even have a mes­ senger call at your home while the guests you invited in for snaclts are there—and probably everybody will remember some­ one far away who should have a Christmas greeting. Did you Remember . . . . . ,to hang some kind of Chrirtmas decoration ou'side the hou-e so passing strangers may enioy some of the Christmas glow that is in your home and re­ flect it around your town? Re­ member, everyone has a part in this Christmas cheer, not just your small circle, and the more w ill gather. IT PA VS TO ADVERTISE Another small farm tract, 34:,/i acres about >/> of which is clcarcd with a good two-story farm house which has G large rooms and a hal'way. Also a good feed barn. This tract is located about IVi miles west of Cooleemee and has a frontage of 700 feet on the Cooleemee Junction Road which is paved and about 2000 feet on a good soil road. Price on tliis place is §90.00 per acre or a total of approximately S3100.00 which is most reasonable considering the value of improvements 011 property. Several other smaU farm tracts in Davie and Rowan Counties, also a goodly number of extra large desirable resi­ dential lots in and1 at the edge of Cooleemee, all of which are either on paved highways or improved graded streets. Our Cooleemee office is located in the business section of Cooleemee in the bui'ding known as the Colton Warehouse liuilding. Write, Call (Telephone Cooleemee 144), or come to see our sales reprsentatives at this office for further infor­ mation as to the prices, terms, etc. They will be glad to show you any of these properties that you might be interested in without any obligation on your part. J. W. Ferrell Company SELLING AGENT 109 Reynolds Building Winston-Salem, N. C. Telephone 2-2936 or 3-4661 FOR ERWIN MILLS, INC., OWNER W II EELS ALIGNED By thc BEAR System For Safe Driving R O B IE NASH 1819 S. Main St. Phone G50 SALISBURY, N. C. QUICK! ru b on ® MOSTEROLE to relieve coughs—aching muscles of ROWAN PRINTING CO. Phone 532 • Salisbury. N < One of tbe largest printing and office supply houMtu In the Carolina*. Printing L it h o g r a p h in g Typewriters C mnpielp J Oflire SiipjjiiHw | AUTOMOBILE SAFETY Glass & Mirrors SH O A F C O A L AND SAN D CO M PA N Y Depot St. Phone 194 Installed —All Models— R O B IE N ASH 1819 S. Main St. — Phone 650 Salisbury, N. C. THMrntscwvyio" ** ijJ-tii'- H ru ‘.' C o. i ’ U on i. -IX SHOAF C O A L, SAN D & STO N E — Prompt Delivery — Phone 194' i/»u t'.iiicrpnse Want Ad YOU NfCD THIS Help Your Cough When colds, measles or flu leave you with a cough get Creomulsion quick bccausc it soothes raw throat and chest membranes, loosens and helps expel germy phlegm, mildly relaxes systemic tension and aids nature fight the cause of irritation. You'll like its results better than other medicine or druggist refunds your money. No narcotics. Pleasant to take. CREOMUIfSION -•licvcs Coughs, Chest Colds, Acutc Bronchitis '.V A W . W .’ .V .V .V .V .V .V .’ . V . V V . V . W W W I C U S T O M B U IL T •U Venetian Blinds - Aluminum Fram e Screens - Aluminum J. Awnings - Ornamental Iron jj Salisbury Venetian Blind Manufacturing Co. % Statesville Road Phone 4319 Salisbury, N. C. • /w W .V .W W /.'.W .V A V .W V .W W M m HNHfT 6KWWM 5SY . . . TAYLOR MATTRES­ SES are so soft and com­ fortable! Every bed should have one of these QUALITY MATTRESSES. T h e TAYLOR MAT­ TRESS COMPANY in­ vites you to come in and see the most popular MATTRESS . . . TAYLOR MATTRESSES. When you want the best for less in sleeping comfort buy o TAYLOR MATTRESS. See your local FURNITURE dealer for informaticn on TAYLOR MATTRESSES. Taylor Mattress Co. SALISBURY. N. C, For Dogs and Livestock S E V E R E M A N G E , I T C H , F U N G I , B A R E S P O T S A N D M O I S T E C Z E ­ M A (p u ffe d , m o is t c a n a n d fe e t; Bar M r t n e s i, ea r m ite s , p u » p im ­ p le * a n d o t h e r sk in ir rita tio n s. P r o n o t e s h e a lin g a n d h a ir g r o w t h « V O U R M O N E Y B A C K . W ILK IN S D RU G CO. PHONE 21 MOCKSVILLE ' aSliorlzed Cadillac - Studebaker Service Perform ed by Factory-Trained Mechanics Baked Enamel AUTO PAINTING■ y 'd jH E C K IN G STING V S epairing All Type BODY WORK Drive In Soon For That Fall and Winter Check-Up 24-Hour Wrecker Service Day Phone 14 — Night Phone 720 IT PAYS TO ADVERTISE Hedrick Auto Co., Inc. Your Cadillac and Studebaker Dealer ■? PH O N E 14 ? 120-122 N. Church St. Salisbury, N. C. jj I. *IR E C T O R Y of D epen dable B u sin ess P ro fe ssio n a l S e rv icean DRUGS DRUGS DRUGS The Best in Drugs and Drug Service. Prescriptions Accurately Compounded Hall Drug Co. Phone 14] Mocksville S T A T IO N ER Y AND JO B PRIN TIN G WHATEVER YOUR PRINTING NEEDS—WE CAN DO THE “JOB’ TO YOUR COMPLETE SATISFAC TION. We Represent LEE SOUTHERN ENGRAVEiiS fcjn f Us T H E M O C K S V ILLE EN T E R P R IS E 6 Pure Crystal Ice O Coal for Grates, Stoves Furnaces and Stokers Mocksville fee & Fue! ^ Phone 110 O Chrysler - Plymouth SALES & SERVICE 9 International* Trucks Davie Motor Company Phone 169 Mocksville 1 WHAT'S YOUR PR0BIFM11 The business firms listed in this directory can be depended upon to solve any problem in their field. No matter what your problem might be — you may find the answer here. Flour, Meal, Feed Stuff and Grain J. P. Green Milling Co. Phone 32 Near Depot Mocksville Help Fight TB Buy Christm as Seals QUALITY D R Y C LEA N IN G & LA U N D R Y M O CKSVILLE LAUNDRY PHONE 190 PAGE TWELVE THE MOCKSVILLE (N. C.) ENTERPRISE TUESDAY, DECEMBER 22,1953 Dulins Gcv. George Smith filled his ap­ pointment Sunday morning at 10. Tlie Lord’s Supper being taken and the sermon being “Christ­ mas.” Mrs. Alton Orrell and daughter, Jan, visited Mr. and Mrs. G. L. Foster Sunday. Little Martha Foster has been sick, but is improving. Patsy and Edward Boger vis­ ited Mr. and Mrs. Adam Baker at Salisbury Sunday afternoon. , | like a bird they walked in the finishing nails and whatever it Mrs. Elmer Hendrix was Sun-, direction of one another. Of course1 takes for completing his new house just as soon os possible. 0 < c i f W h a f t o g e t h e r f o r C h r i s t m a s ? f t A N ELGIN, OF CO U RSE! | & W h e r e t o g e t i t ? $ •%, STRATFORDS OF CO U RSE! M ELGIN NANCY 17 jowels$337S ELGIN DARIA 17 jowols$4250 ELGIN RITA 19 Jewels $62so LADY ELG IN MARTHA 21 iowols$8950 Prices Indudo Fed. Tax Only Elgin has the heart that never breaks, the guaranteed DuraPowcr Mainspring.□ Choose from our complete selection of Elgin — Hamilton— Bulova— Longines —Benrus day dinner guest of her mother, the sound kept getting louder Mrs. Roy Burton of Elbaville. | and each was expecting to soon Mrs. John McCulloh, Jackie and see the bird. Leona McCulloh shopped in W in-j It wns rathcl. surpl.jsing, or ston-Salcm last week. , i say shocking, to say the George Boger arrived home on Vvhen they came face to face December 11 to spend his leave w m, ono another and each saw with his wife-and mother. He left whal his bird reaUy was_ Sunday morning for California j _________ where he will be stationed for a, A fcw tips for Santa. few months. He was accompanied, sheriff Alex Tucker and Dep- to California , by his wife, the uly Ranspm Cook would appre- former Margie Barney. | cjaiej j’m Sure, a pair of blood- Mrs. Ralph Potts and Mrs. C. H. | hound. Having had some ex- Barney shopped in Salbbury las perience with these animals in Thursday. tracking suspects, I’m sure they The Christmas program will be rate at the top o[ theh. Christmas presented at the church Wednes- j;st day evening at 7:30 p.m., Dec. 23. . The Sunday night prayer ser- P.S.: If you don’t have blood- vice was conducted by Betty Hen- ^ hounds, just any old dogs will do, drex, the subject being, “The Birth Santa of the Christ Child.” For Oscar Cook and Frank James— a few good cow chains sot hat they may rustle up some more rabbits. Never mind the guns, Santa. For Mayor John E. Durham— a J revolving secretary to assist Miss ! Nancy Glasscock in keeping tabs on her bor.s. It’ hard to keep up NOTICE TO CltEniTOKS H aving qunlintd os E xecutor of tho cslnlo o f Chnrles L ow o Thom pson, clo- censed, n oticc Is hereby given to nil persons holding claim s against said es­ tate to present the sam e, properly veri­ fied, to the undersigned on or b efore the lDllu dny of D ecem ber, 1954, or this notice w ill be plead In bar o f recovery. A ll persons Indebted to safd estate w ill please call upon the undersigned at M ocksville, N. C „ and m ake prom pt settlem ent. 12 24 Gt This llKh day o f D ecem ber, 1053. CH ARLES LOW E TH O M PSO N , E xt- cutor of'C h a rles L ow e T hom pion, decs’d. ADMINISTRATRIX'S NOTICE North Carolinn—D nvie C ounty H aving qualified ns A dm inistratrix of the estate o f B. C. Clem ent, Sr., deceas­ ed, late o f Dnvie County, N orth' Caro­ lina, this is to n otify all persons having claim s against said estnte to present them to the undersigned w ithin tw elve m onths from date hereof or this notice w ill be pleaded in bar o f their right to recover. A ll persons ow ing said estate w ill please m ake im m ediate settlem ent. 12 25 Ot This the 18th day o f D ecem ber. 1053. AN NE CLEM ENT, A dm inistratrix of 3. C. Clem ent, Sr., dcccnstd. MORE ABOUT T ID B IT S Curtis Price, who lives just a with a man who may be butch- short distance from Mr. Branch, ering, selling Insurance, or ol'f heard his neighbor and thinking somewhere looking about the it was a bird also started to mock business of the town. it. I -------------- As each of the two men made! For Bryan Sell—a few more S>3tSl3l3l2l3)SlSl9i3l3t3i9l3i3lSl3;3iaaa3l3)3l3<Sia3i3i3i3i»ia3)aa3iSi3i%3)3iaa%Siaa3l3ias^.S^,3i^^iii.%9)S]3l3)3)3)3tSi9iSt3i9t3)Sg3i»g»i9)3i3)S)Si9g3]3i3i>). V S)St9l3l9l3lSi3l9lStSlSt3tSlSl3lSt9l%SiSi3l9l2l3lSlBt3lSi%3lS)S!3)Si>l9l>t9i9l3)>l9t9l9iStSlStll Christa M a y T o u r H o l i d a y b e a G l a d O n e Wilkins Dm, A Merryt Merry Christmas to You . . . s Iv f THE REXALL Phones 21 & 400 Co., Inc. STORE Mocksville, N. C. “THE KING O F DIAMONDS" Stratford HONEST VALUES CONVENIENT TERMS • JEWELERS n Old Fashioned Christmas al home rt f with tho family gathered lor the singing of carols and riN Most important meal of the year...It's a happy scene in which we're pleased to play a small part... To our customers and friends, one and all, we wish a Merry Merry Christmas. —The Staff W E W IL L B E C LO SED F R ID A Y , SA TU R D A Y & SU N D A Y . Make it a Merry Christmas with this Candy R ecipe!] O i Carnation'* famous Velvet Fudge . proved ihe best for years and years... is the favorite of hundreds of families who *•' prefer traditional fudge. North Main Street Mocksville, N. C. Kie!eieieie>€ieis«!eis«igt6!stg!gigig!sigigisietsig!e!sigieieisie(eigtgig!€tsi€!etcigt6ieieieis Tenderized H A M S ...........69c lb. S P IC N IC S ......43c lb. H E N S ............49c lb. Bronze Double Breast I T U R K E Y S , 7 to 14 lb. H E N S ..............69c lb.c (Z a i t t a tiO M “1 / e tu e t (M akti about 2 pounJtl 3 •quarts (3 ounces) bitter chocolate 3 cups gronulated sugar2 tablespoons light corn syrupt cup undiluted Carnation Evaporated Milk3 tablespoons butter ' I teaspoon vanilla Place chocolate, sugar, corn syrup and undiluted Carnation in saucepan over medium heat. Stir until chocolate melts. Cook until fudge mixture forms a soft ball in cold water (or 2)4°F. on candy thermometer). Remove from heat. Add butter and vanilla: allow to cool (110° F. or until nan is cool enough to hold in paim of hand). Beat until thick and creamy. Spread in buttered B*inch or 0«inch pan. When firm, cut in squares. I | TENDER JUICY Fryers 39c lb istetsistgteteietswttgieietgtetsisieis^tswistsisieisistsisigiaigseistg 2 DOZEN SIZE t o * / l o t / t e f y l c l / t / ■us Christmas Time is Here What more would your Mother like than a picture of your family group? Pictures of the children, or Mother and Father for the children that have homes of their own. A PICTURE NOW . . . A TREASURE FOR TIME TO COME Pictures made at night by appointment now until Christmas Pictures Frames Cameras Film Books Children Books Bibles Plaques Egg .Nog .... 83c qt SWANSDOWN White Cake Mix 39c Round Steak 59c lb ;tais!gie!gtsMjig!£>e!c(«t5i5!sigtej g!eieisisi€ie«!€!etgietsisi€'g«teig6 Cabbage 3 lbs 15c 2 for 29c ZE Oranges...........................29c doz Pecans "‘2 lb bag 69c Tangerines - 29c doz C A fiV A T /O M M t l K 3 Tall Cans 39c S’I gy i f Qficc/k l/e C/Ca/fa 216 SIZE BORDEN’S NONE SUCH CHOCOLATE COVERED Peanuts 32c pkg 2 LB. BOX Stick Candy 55c § KING • Mix Candy 1 lb 29c BLUEBIRD a p y . <@ome <Mt/e 3 ’a il Mince 'Meat 27c pkg \ JIFFY ' Pie Crust Mix...19c b can 89c LB. PKG. 49c ei- J %o ’ STREITRIAN COCONUT $ Canada Dry $ rt » a -- « a «3 § « 1 Mft Canada Dry Ginger Ale 2 qt bottles 39c g s ■8 w u a n a a a u n £? s? s? s? s? 1 LB. PKG. y s? i f w 3 ■ ¥ig!€tg’crc!«ieie'a!sis'c!cic!e’e'€is,«i(j'-€’c,€^ie««,-e'€^'«,c ,2tet£:ts g eswIa % I :OOiaes for the H OLIDAY SE A SO N W h e n frie n d s d ro p in S e rv e C o ke a n d S n a ck s 6 bottles, 23c- w _ « _ * & *Sl ff I nnpar. P,lpn | . [ Maxwell House g j Pink Salmon 39c rtrtrtrtrtrt r ttCoffee 89c lb SMith stud IO Phone 360 137 Salisbury Street Mocksville, N. ¥ * 1W E S T E N D G R O C E R Y WILKESBORO STREET MOCKSVILLE, N. C. THURSDAY, DECEMBER 24, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE M e n /iu A l l • • V ' Santa Says It . , We Say It Too Our Heartfelt Wishes for -.your Happiness Day, and all the Christmases hereafter this Christmas . 8 ^Mocksville North Carolina PAGE TWO THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 24, 1953 9.5lSl3.2iaJ;a&3:»;*Sl*S;S!SlS;aSia3j5:5!5;>jBlM>JOUif3i3:3l3iS)3iS!5l9i9!9l»S^i*5!3! fi K « 8 %«W /IP& 8 a TMAS THOUGHT ENDLY W{$H . . i y this message convey to you our best wishes for mas -that wifi long ifee: remembered. Christmas Card Boger and Howard Service Station Mocksville, N. C. IKWHIBM IlllllW WIWISWBW^WWWWieKlWg'OWICCTgP retW O I A LITTLE CHRISTMAS MOTE Of Christmas cards are so much a part of the modern Yule season thnt one seldom stops to wonder how the Idea originated and by whonV This simple idea of wishing your friends a Merry Christmas brought honor and knighthood to the orig­ inator, Henry Cole, a middioclass Englishman. Cole mailed his cards on a De­ cember day In 1B4G. The cards de­ picted a Victorian family assem­ bled at the festive board and the traditional Christmas custom of giving to the poor. They all* bore th« now-classic greeting: "A Marry Christmas and a Happy Naw Year ta yau." ' Be had a thausand •< the aards stratk aff by a lithograph. They war* Huh a success that plain Hanry C*ie subsequently hm— t Sir Heary Cole. 7Y« aards we send M ay, haw- avar, a far ery front ttiaae mallei by Cala, The cards yan send awl reaalva this year will he derfgned by tanaaas u m et ia cantaaipaaary art. Aa American *appiag far aards thle yaar may select soanes paisted hy auafc iatnauc peaple as Wlaataa CharahiU, Britala's prime mlalater and tamed amateur artiet, and Grandma Vases, ane ai A atriat’i anast fcssaus artiste. 1%a demand far oards la aa fraat that aaaay aotnpaniea apand tktir antira time ia designing aad pr*- duelag tin t far the haliday aoa- Smoot Shell Service Mocksville, N. C. 3'>J5<3i«*f,S>,»JaS;>,SiaS,&.5iS;aa5;Si2;5;SJiSi?,>.5l2iS’laaaiaft5lSiS!Si3i*5iJi3ja( IIAPPT IlOLIDAT . . . A parade make* It a happy holiday for ahtldrea. Kvary yaar Mary’s af New Tark haa a ff-iffantio pre- Chrlstmaa parada. Bara ascitad yauacstera watah the cay spec­ tacle. n e y ara havlag tha Mma.af IM r llvaa aad the aacnc will be rapeatad hi haidrada af tawaa ihraackant tha eanntry this Christ­ mas aaaaaa. Somking tobacco output dur­ ing the year ending June SO was about 93 million pounds, nearly 8 per cent lower than • year earlier. Prices received by North Car­ olina hateheres for straight run heavy and crosa bred chicks on October 1 averaged $15.50 per hundred. mrwan ------------ - M1UI. SANTA . . . She ta Uve- ly. This is Miami Boach's ver- siaa af Mrs. Santa dolag her chimney climbing in tha warm southland. It is our holidoy ^vish that this Christ- ^ ttqs will be the "happiest ever" «nd , - that the Hew Year will unfold o bright new future for vou. Davie Packing Company jj Route 4 Mocksville, N. C. As the years roll by we realize more and more how much it means to. have the confidence of folks like you. It is a pleasure to wish you -O ■' terry Christmas. Foster’s Cotton Gin Mocksville, N. C. V $ 1 1 ealrti \p br?iqKt , i A Shoaf Mocksville, N. C. m m M1 .isteisis«ie!ei5!S«,«!a!e«ieisists<e'5M:is«!a«!!iat«ts!C!s'e!eis!s<€*l«'ei«i«'€fEi®ig>«!€is>g 9HA3l3l»l>!3i3i3t3i3i9i3t3i3i3i9iSt3i3iSi%Si3g3i3nSiSl%3i3i3iSi3i3iSiSt3l%S)3i3i3lSlS;9i»i9g3i a % If & & As we present our greeting< to you on this glorious Holi­ day occasion, we offer them v • with happiness in our hearts for those about us. A-very Merry Christmas to all. /YYVflAAy 0 ruz. ‘CsH.XCiSS.t I Smith-Dwiggins Lumber Company 1 "-v The door is closed, but only to keep out Mr. Frost. The wreath says, “IT ’S CH RISTM A S. A L L A R E This is the spirit of the Yule in America. The family gathers for the celebration. Friends visit and exchanged. Ours we offer now to all of you with the added wish for a H A P P Y N EW Y EA R . BANK OF DAVIE W ELC O M E.” greetings are ,1_______________________Mocksville, N. C. THURSDAY, DECEMBER 24, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE PAGE THREE ^ jR eG T IN G i^ H==i - o - 4 - T r r 3 f 'O =fcS==; \ND a SONG OF j good CHEER / \ a ‘Mocksville, N. C. B Pif i an« »yif»wW y 8yifyyyyuififygs& Si Small Towns First to Light r Trees fi liM ft £ s*5 . ft AIs-RRXRRRIRti fi8 . Jn Thank you, friends and neigh- r -* » A A A * hors, tor your fine cooperation L r /$ ] and helpful courtesy in the. past [ Al / M , . . . pi\ year. \Vc look forward to a I W' siS5, bright future and hope j’ou will I .J ify jil rcecivc a generous share of the I. good will and happiners so [ ■much in evidence tc-J.-'y. r (NCERE i i ^1' &nfi£vna«aKa $it«K«s«H fl£R Bill People’s Grocery Route 4 Mocksville, N. C. % I i i i * To thank you as we’d like to Is for beyond our powers For if we had no friends like YOU There’d be no firm like ours Mayfair Beauty Shop JO COOLEY, Owner LESSIE YORK Operator Mocksville, N. C. BONNIE PEOPLES Operator 1 a IT-pH ijoup hcai* £& §1II £ poacfc' a tli4- com m cj tli true tap piness, J-LnnCj i-jOu jot] ReNu Cleaners It wns a small town that first thought of lighting an outdoor com­ munity Christmas tree. Four communities are believed to have thought of the idea about the same time—as early as 1913. Two o£ them, McDonald and Ger­ mantown, wore in Pennsylvania. Salem, Ore., decorated a large Sitka spruce. Riverside, Calif., illuminated a large evergreen, an Aracuriu. The first national Christmas tree was in 1924 and was sponsored by the American Forestry associa­ tion. The event is now televised every year for all parts of the country to see. The most spoctncular outdoor displays in the United States are at the White House and Itoclse- feller Center in New York. The New York display is possibly the most elaborate-in the world. But it was the small towns that first thought of the Idea.’ Today, nearly every community in the land has some kind of Christmas decorations. Many com­ munities string colored lights across the street and decorate light posts with evergreens. Many suspend bells and stars at street intersections and have dazzling community trees. The idea was eonceived by a Danish postal clerk. He thought of the idea in 1003 while mailing Christmas packages and letters. The clork was Einar Holboeil. He mentioned it to his follow work­ ers and they decided it would be a great help in defraying the cost of fighting tuberculosis. The idea reached King Chrlslan, who ap­ proved, and the image of Queen Louise was paced on the first seal* in 1904. Jacob Rlls, Danish-born Amer­ ican, heard about the Idea and sold it to the American public in 1907 through a magazine article. A Rod Cross worker, Miss Emily , a,\i Bissell, started the first American ' sales that year. ! ^ Door Decorations In the last few years it has be­ come more and more popular to decorate doors and doorways with bells and tree ornaments instead j ^3 of the conventional wreath. ' *~ Your door and window frames can be made bright and cheerful by framing them with ribbon and sprigs of holly. You can hang the ribbon in festoons across the cur­ tains and tie at the’ sides in wide sash bows for. colorful effect. CHRISTMAS SPIRIT . . . Full of Yule good fellowship, “ Blngle” tries to arouse some ditto in the feline heart of “ Ginger.” Ginger, goodwill season or not, can't get over her distrust of dogs. Y u le S e a l I d e a • W a s F ro m D e n m a rk This year millions of Amer­ icans have received a letter from their local chapter of the National Tuberculosis associaUon contain­ ing Christmas seals, the seasonal reminder ot the never-ending fight to stamp out the disease. ANGELS WITHOUT WINGS . . In the Children's Aid Society Jones Center, all was calm as the call for rehearsal of carols was sounded. The little angcis without wings took their places, with one moppet sporting a black eye. He couldn’t resist reaching under his cassock to be sure his treasured gun and holster were still there. United States production o£ Brussels sprouts is largely con­ centrated In California and Newt York where commercial produc­ tion for fresh rnalket in 1952 ex­ ceeded 4,000 acres with a market value of more than $3,500,000. P W w raK tgtcgiew w gtw reratgtgigigtgigigittgtgtgigigtsigieiggKigt&gigiggg^ »9)>ia)Sl>lSlSt»l3tai3t3i3)9;3l»%3l>l>lk3)>i3)9aiSl>i9)S!Sl3)a)£l3l3t9lSl3:»9i>I»l3lSl»Sl»g I Hupp Feed Mill M O C K S V ILLE , N. C. jwcifgigtigicnigiggitigiMitnwtgmgictgitgigigtgmwcgitigiMicitigigttigmgii I H A A risftnas Route 4 Mocksville, N. C. PAGE FOUR THE MOCKSVILLE (N. C.) ENTERPRISE G»i3)3l3i»iB)3)aiS)3tft»Sg3)9l»l9l3lSl3l9l3)9l3) »8l»S lkSl9iSt9l3l3)9i>l9l3l%Sl9lSl3l9ia9l5l9l X %%S)S)9l2lS)9l3)9)Si>i9l3)3i>)>i9i9l9)>iS4Si»i9iSt9)3i3tS)>)Si3)3]SllgSi9)2i>i9i})9i>i»)>gk9iM S | Hy THURSDAY, DECEMBER 24, 1953 i sieetirtfd Wishes for a MIL H0LID1 SEflSOn J. E. Cassidy Store Route 2 Mocksville, N. C. yyyyy Sfs?wwWM W■WSf»»fc?Mwwws>SfyyyyyyyyVyyy-W5? Dorothy Boys Ktllan Y OUNG Mrs. Frank Sanderson hung up the telephone receiver ‘and stared bleakly at the beauti- I fully set dining table. The Santa ! Claus sleigh centerpiece filled with ! red and white striped candy canes, j the sprig of holly at each place | setting, the gleaming silver—was jit all to be for nothing? j "I’m so terribly sorry," ner mother had just said over tho | phone. "We simply aren’t going to Ibe able to make it for Christmas ! dinner. The roads are just a sheet ) of ice—” i ."Oh, Mother!" Eva had ex- j claimed. “ It won’t seem like , Christmas at all without you here. iAnd Frank and I were so excited : about it being our first time to '■have the family.’’ 1 "I knew how disappointed you’d be, Eva," Mother answbred. ‘‘But Dad says it's just impossible.” "Oh, Frank!” Eva was close to tears. ‘‘It’s going to seem so queer without Mom and Dad.” “ I know how you feel, honey,” Frank put an arm around her comfortingly. "And what’s more, igt6igigigigigigigtggigitiot»gigieigigigigtgggteig<g»gigig»g»6igtttgiggigi6»g'gigtg»gigig»g»g 3lS)3t3l3t3)3l9)3lSl>l>lS)>iai3iSl9lSl3)9l3i9l3l3l9l3lSl3!3)%ai»)3ia>3l3iSt3i3lSi9l9l9tSl3lStSl%: £ I I te |I I I ft s § $ 1 s £ §I I I ' i D. D. Bennett & Sons C O R N A TZER m%««m«w«m>e*re>cte'cie'c'etgictcte'ete«!«ic'e'etev>ete'cte!ctg'ctetcte'stetc!«ie ~^Simra!>!Bl9)Sl3l3l>tSl9lIgai>i3i%3l9i9!Si3)%9l9l3)St3t3lS)>)3l3t9l3l>>3t3i3iS)3l3iS]Sg3iSi3i H M ■CcS . _ _ _______ ^ACH year, offer a little messoge to tell you we are remembering all the nice court­ esies offorded us in the past and to let you know we truly appreciate your thoughtfulness and consideration. So, while you are enjoying the fes­ tive Christmas season, remember. yyyyy §ify S.yyyyyyyyyyyyy .sy Sy ft 1 1 I i % § i<15 .1 .« 5 £t ia ■3iA I■s a §%A<*ajn ti3 (2lixi±tmai C D\j-st Sy y §if I I § y s5yyy■ 9y M€RRY CHRISTMAS C. J. Angell Appliance Company Ktet£te:e«te«is««>c<e%<ae!a£%«tetstg«te'gt£%ie«'£««««'g«tg«tg'c'etctgtE<c'e!S!e “ I know how you feel, honey.” Frank put an arm around her cemfortingly. what about all that food sitting around in the kitchen?" ‘‘We'll just have to find some- . body to eat with us." Eva wiped her eyes and looked thoughtful. "Let’s see, can you think of any of our friends here in town who hadn't planned anything special for today?" "Well," Frank said, “the Spring­ ers are eating with his folks, the Albrights left by train yesterday for Detroit, the McCalls—oh. you know as well as 1 do that every­ body's dated up. You just don't 1 e a*v e Christmas dinner to chance." ' “Frank! What about the Aaron- gaards? You know that fisherman and his family who live in the cottage down by the docks?” • “ You mean that tall, quiet guy with three or four tow-headed kids?" . "Yes; and I heard someone in the post office yesterday saying they’ve been having a struggle late­ ly—the river’s been so ice-blocked that he can't get his boat out to the lake, and there’s nothing com­ ing in for them.” “Honey, that’s a swell idea!” Frank a gr e e d heartily. "But what’ll we tell them?” "Why, just the plain truth, that our folks couldn't make it at the last minute and we’d be so glad if they’d substitute for them.” “Maybe they won't believe it,” Frank said. "They've got their pride you know, people like that don’t want charity." “Just try anyway, Frank,” Eva pleaded. “Go ahead and phone him right now.” "O.K., here goes.” And Frank went to the phone. A minute or two later Frank hung up the receiver and shook his head. “Just what I was afraid of,” he sighed. “ When I first start­ ed to talk, and wished him Merry Christmas he seemed tickled to, deatW that we’d thought of them, • but the minute I mentioned the in­ vitation he froze up and said very politely that they had their own plans. He just didn't believe the story." Eva looked crestfallen. But after a moment's silence she suddenly said, "Let me have that phone,” and hastily dialed a number. j “ Mr. Aarongaard, this is Mrs.] Sanderson. We’re so sorry you' can’t come to dinner here, It; would have meant a lot to us. But I'm calling this time to ask a favor of you. “I understand that you go in­ land to Brinkvllle every week or so to deliver some fish orders. I just wonder if, the next time you go, you'd be kind enough to take my family's gifts to them—their farm ,is right on your way. •‘—Yes, all their things are un- jder the tree here, We naturally ex-, Ipected them to pick them up when, thej; came to dinner, but—” j i Eva began to smile as she: listened, and then said cordially,; "Oh, fine, we’ll expect all of you; at. about three o’clock. Good-bye; .'til then." And she hung up the; receiver. ' | "They guess they.’U come after,’ all, if we don’t mind their changing! their minds,” she reported hap-| pily. * I "You're a smart little wife if I do say it myself,” Frank grinned, "Come on, let’s shove that bird in th^ oven." ^ More than 1,800 North Caro­ lina communities, including some counties, are served only by triicks. ftftftftftft€ftfa« Ift 9ft I ft , 7Carolina vo/ces or fn/h J l i a f c o u l d t h i s m e o n b u f ' ~ t ? h r i ' s t m a ’S ? _________ / The crackling of holly leaves, mistletoe over the door, caroling voices of children . . . what else could this mean but Christinas? Yes, that joyous day is here and we of this organization wish you the most delightful on* anybody could have. * Mocksville Implement Company M O C K S V ILLE , N. C. yyy iy'yyyyyyyyyyyyy S * S Iyyyyyyyy M A Y T H E S P I R I T O F C H R I S T M A S - “fieace on €artf) (goobtoill to Jtten’ R e i g n u n c h a l l e n g e d i n t h i s w o r l d f o r ­ e v e r m o r e . . . A m e n 8 8y 8 y I / Davie Freezer Locker M O C K S V ILLE , N. C. «ietete(eieicicicieiei(icicic>c«ie(eicie>cieiCic<ets>(ieie«ieietewieteie<cteicieicictciM>c>c e - R o O W l l f © * eiEoeiJku.. U ! M a y t h i s c i r c l e s y m b o l i z e t h e g r o w ­ i n g c i r c l e o f f r i e n d s w h o m i t h a s b e e n o u r p l e a s u r e t o s e r v e t h e s e p a s t y e a r s . W e a r e g r a t e f u l f o r t h e s e a s s o c i a t i o n s a n d w i s h e v e r y o n e o f y o u a J o y o u s S e a s o n . -■ M ERRY C H R IS T M A S u s W%m tg!gtgigig!eie«ie‘e>£ie<e<e!eie>e!st«is<et:ie>5ie>eieici«>sieie’«>s<eieieis<e>e)3ie<se<ete>c!e>eieieiete«i«icieieieie THURSDAY, DECEMBER 24, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE PAGE FIVE Bowles and York | (SINCLAIR SERVICE) g 1 M O C K S V ILLE, N. C. I 2 s? 9)%3lSl3l3l3)3t9i3l3i3<3)3<Si3)S'>3>3l3l3i9>%9i3:3!Sl3i3l3!Sl3iS)Siai3;3)3lSiS;3;3l9l3l&l3lSt3i3t i ' 'Pi s w i t h A L L G O O D W IS H E S ' V FQK T H E H O L ID A Y S Ellis Cash Grocery M<ct<!c!c>ctc«tc>c!etc,.stg!s!e!s'e>£!gtsistg!stgtstgtg!gi£!gtc!e!g's!g!g’£tgtg!e's!gtgts!s!e<& atS)l>S)»9:9>3t3)9i3i9l9)>i9)3)3i3i3i3iS:9i3]9i3i9iSt9i9l3)XX9]9)3;SiS)3)9)Si3)9i3t9g%3t3iSi3iIy § . ' OUR.. WORDS ARE FEW—THEIR |j MEANING HEARTFELT. , A JOYOUS I ; HOLIDAY TO ALL OF OUR FRIENDS I .Hendrix and WardI.| Implement Company I M O C K S V ILLE , N. C. NO. 1 GRANDCHILDREN . . . Grandchildren of President Els­ enhower get a look at Christmas dolls. They are (left to right) Susan, B arbara Anne, and Dwight David. The children spent last Christmas with their grandparents at 60 Morningslde Drive, New York. Dr. Clement Moore Was Ashamed of His Famous Poem Dr. Clement Clarke Moore was ashamed of his famous poem, "Night Before Christmas" and would not acknowledge that he wrote it for more than 20 years. Today, the poem which begins— ' Twas the night before Christmas, when all through the houseNot a creature was stirring, not even a mouse;— is one of the most beloved of all Christmas writings. Dr. Moore was an aloof profes­ sor of Greek and Oriental litera­ ture in the Episcopal Seminary in New York. He wrote the poem on Christmas Eve 1B22 and read it to his seven children. He had not planned for the poem to go further than his own family, but a relative who was visiting the Moores put a copy in her diary. The next year the relative’s father sent it to a newspaper. Other newspapers printed the jingles and they quickly became known all over the country. The dignified Dr. Moore was embar­ rassed and considered it beneath a man of his scholastic standing to be the author of children's jingles. Twenty-two years later, how­ ever, he finally publicly admitted authorship of the jingles and it was published in book form under his name for the first time.------------- The ratio of trucks involved in highway accidents declined for the fourth straight year in 1952. , Santa's heading this way. He nay come by plane, liner or stream­ liner, or he may hitch up Donner and Blitzen again, he may even hitch­ hike— anyway he's heading our way and we'll be rpighty glad to welcome him. May the old gent favor you with a multitude of nice things and an abundant share of happiness and prosperity. ____ WATCH SH O P "ON THE SQUARE" Mocksville, N. C. arrival o f another Christmas season brings with it the joy­ ous recollections of many pleasant and friendly associations with those whom it has been our pleasure to serve in this community. £ a c k year we find our­ selves eagerly awaiting the Christmas season because in it we find the oppor­ tunity to express again our apprecia­ tion for your thoughtfulness and con-' sideration A ttd as we extend our thanks, we hasten to add our best wishes to you for the Holiday Season. May it be one of manifold blessings . . . a time of merriment and thanks­ giving. May this Christmas be your happiest. ' . DAVIE MOTORS, Inc. -- North Main Street Kte<ctets>c>c'etc‘cie:c!ae<&&£%>z%1£%<s%!s%:r's:ets:s>e‘'s'si;>e!e<£%tc<e>e%<a%‘s‘c'£'e PAGE SIX THE MOCKSVILLE (N. C.) ENTERPRISE .THURSDAY, DECEMBER 24, 1953 ! By Ghirley Sargent m l ABSOLUTELY refuse to cook * another Christmas dinner," Sarah Kilbyo announced (irmly, i hardly daring to look at her startled husband. But Paul didn’t argue at all. '‘We’ll go out," he agreed, “I'll bet you spent four or five hours in the kitchen when we had the rela­ tives for Thanksgiving. You missed all the fun." "You mean go to a restaurant?" Ten-year-old Peter made the words sound evil. "Guy, who wants' to do that?" "I do," his seven-year-old sinter, '.lean, rallied unexpectedly. "Then I won’t have to set the table!" Sarah picked up her three-year- old. “Would you like to go to a restaurant for Christmas dinner,' Kit?" Kit stared soberly at her. "Do they have drumsticks?" “Sure." "Okay. I'll .go.” ‘.‘Looks like, you're outvoted, Peter," Sarah smiled. “ Yes, I do,- It won't be like Christmas to eat out.” "You just like the easy part, son,” Paul said, “ and mother has Saxnh picket! up her tliree- year-old. "Would yuu like (i» go to a restaurant for Christmas' . dinuer, Kit?” all the hard work to do. This ytiai we'll make (t a real holiday for her.” Christmas was on a Thursday and, that afternoon, long, after the last exciting package had been opened, the Kllbyos drove to a nearby restaurant. . Peter looked across vthe table, “Sure seems funny not to have Uncle Tom an’ the rest of the family with us." "The ‘rest of the family’ adds up to fifteen people,” Paul remarked ,"\y1y, “ nt $2.5P per plate." Peter didn’t say any more, but ■iarah know hoA he felt. It did seem odd. almost lonesome, to see only five of them around the table and she missed watching Paul carve tile turkey. When their orders came, the turkey slices wore already on their plates, al­ though Kit had his drumstick. "I wanted while meat." Jean said, "an' they gave me dark •meat!" Qulckiy, Sarah gave Jean some of her white meat. The turkey was I good, but the dressing wasn't near- ! ly as moist as she could make and the gravy seemed a trifle greasy , Neither Paul nor Peter ate j much as they would have at home, i “Just think,” Sarah said cheer- < fully, "no dishes to wash, and ! wipe." "No leftovers either,” jean com­ plained. I "Yeah, no turkey sandwiches or anything," Peter growled. "Golly, ■ mom, yqu could make better pie than this." > “ At S2.50 a plate," Paul said loudly, "and you kids have tho j nerve to complain!" / "Shhh. quiet, dear,” Sarah tried ' to hush him, "people are looking at us." ! “ It's like eating in a goldfish bowl," he said quletly. j Just then Kit's pie went flying ■ off the table and he let out a howl that. echoed around the dining j room.. Now everybody was looking I at them and laughing with Paul I and Sarah. But Peter and Jean were blushing, embarrassed to be the center of so much attention— good-natured or not. Only Kit real­ ly • enjoyed the confusion as two waitresses cleaned up the spilled pie and brought him a new piece. A la mode, this time. ‘‘Hey, look," he yelled delight­ edly. “1 get ice cream too!" Again the people at surrounding tobies laughed, but Sarah was as redfaccd as her children. "Honest­ ly." she sputtered, “ if I’d known . . , “Next time," Pa’ul interrupted grimly, “we’ll get a private dining­ room." "Next time, I'm slaying home, even if I hafta eat shredded wheat,” Peter said defiantly. Sarah laughed, "There isn’t go­ ing to be any npxt time here. Peter was right, it doesn't seem like Christmas to eat out. There’s nothing to look forward to, nothing left over and it isn't as good as home cooking, NexJ tjme, we'll have all the relatives at our' house." "But the work," Paul protested ‘Oh, nuts to the work. I hardly knew what to do with myself this morning. What do you say, kids?" Jean just grinned, but Peter safd, ‘‘I say fine, I'll even help with the dishes.'11. SiXaiBlSlMlMiMiSlSaagllNKIlSlKMlSiftSMUilkMlSlSiaiSiatMtMlSlkMMikSi' CHRISTMAS Allison - Johnson Co. ' O n c e A c a in W e G r e e t T h e C h r i s t m a s H o l i d a y S e a s o n W i t h A T r u e A p p r e c i a t i o n O f I t s F u l l M e a n in c . M a y I t B r i n g Y o u P e a c e , J o y A n d C o n t e n t m e n t T h a t W i l l Re- .m a in W i t h Y o u A l w a y s . Sheffield Grocery Mocksville, N. C.Route &‘(M«K'm««wra««<c!cec>ce>c<ete«<s<e«!C!etc<<'c‘s‘e>e‘e<£>e>c>e*cv1c>cictcts>e>c« % Mocksville,. N. C. K«««««%«%«ttts%%%«%«%«««>eieigtetgtgtctgtctctetc>«tct«ic<e<ste<c<c(c<ctc<c<c<c' S / '■> I We very much appreciate the opportunity you have given ut to serve you in the past and even more do ive appreciate youIas a friqnd. . May we deserve this friendship always. American Cafe Moclcsville, N. C. Davie Tractor & Implement Co. Mocksville, N, C. T h e r e c o m e s a t i m e o f t h e y e a r w h e n a l l t h e p r o b l e m s a n d u n p l e a s a n t h a p p e n i n g s f a d e i n t o n o t h i n g n e s s , w h e n w e f i n d i t e a s y t o f o r g e t t h e d i s a p ­ p o i n t m e n t s o f t h e p a s t . ( C h r i s t m a s o v e r s h a d o w s t h e s e u n h a p p y e x p e r i ­ e n c e s a n d w e s e e b e f o r e u s a l l t h e f i n e t h i n g s o f l i f e / t h e c o u r t e s i e s a n d f a v o r s o f l o y a l f r i e n d s . A n d s o , a s y o u w e l c o m e t h e C h r i s t m a s s e a s o n , p l e a s e r e m e m b e r t h a t w e a r e t r u l y g r a t e f u l f o r y o u r f i n e c o n s i d e r a t i o n . E. C. Morris IN SU R A N C E AND R E A L E S T A T E M O C K S V ILLE , N. C. THURSDAY, DECEMBER 24, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE PAGE SEVEN g 81 ft . fh EASANT ^ CUSTOi The traditional practice of extending Season's Greet­ ings is a peasant one for us. Each year we look forward to , v ^Christm as because it offers splendid opportunity to express our sincere ap­ preciation to each of you. Davie Lumber Company Mocksville, N. C. | H. • . . . « ITH EVERY GOOD WISH “C” Ward’s Barbecue i Mocksville, N. C. cwMWctcmwctvciccictrocteiawmteraw'mtcir-fi'cctgtcwtmmtrawnmtiK BIKINI CHRISTMAS . . . They, may not have snow, but it’s Christmas In Miami Bench, too. Hilda Estcves g;cts Into the Yule spirit hy dccorating a pool-side tree. Helper is Ellen Sweet. Joseph Proved His Love for Mary, Mother of Jesus Joseph, the bible relates, had to prove his faith ia and love for Mnry before they were married. It is one of the great love- stories •f all times. When Joseph thought of Mary, he forget the difference in their ages: »he was the girl he had waited for, his beloved. They were espoused—»r, as we wffuld say, en­ gaged— wfcleh was almost as of­ ficial a* koine married. His heart soared ea wings of the approach­ ing weddiag day, and thea . . . What Uary Insisted had eeme te pass, simply eeuld not be! Joseph wanted ie»l»er»te!y te believe Mary, hut >uch things just didn’t happen, and If they did, they hap­ pened te somebody else.............. . Much as ha loved Mary, Joseph was a righteous and God-fearing man and while he eeuldn't even think of making her a public ex­ ample, he had just about made up his mind to put her away privily. That is, he thought he had made up hi« mind. In his heart, he knew he eouldn’t; what would become of her . . . of her ehild . . . Then one night, after he had ex­ hausted himself with tortured thinking, he fell asleep and the angel of the Lord appeared to him ia a dream: faying. "Jtteph, thau s*m e/ David, fear * 9 t. .."And when Joseph awoke, be did ai the angel had bidden him, and tttk Mary at hit lawful and therithed taife. “Fear net,” the angel apoke un­ to Joseph. . i IT PAYS TO ADVERT1SK taiKfeM&MMxxiimftMJisimMmMUMitxkisiasiftMtamsiaiKMkftBSiStKftSiftMtkftsiftisiKitMtKftsiftsixai ii&§ !I it6 5 \1t >!3l5l SlSl S iSlSlJiiaaSl S;Sl>,Sja*!*-,SiSISl SiSi SiSiSi^Si 9i») >19i»>i9i» >1 JifcSiaiaSiJi 9i>i »i») >■,*»! 5131 8 s I ! 1 £ MAY THE COMING YEAH BESTOW UPON YOU GOOD HEALTH, HAPPINESS AND FRIENDSHIP — THE MOST IMPORTANT POSSESSIONS IN LIFE THAT MONEY ALONE CAN’T BUY. M AN Y TH A N K S FO R Y O U R V A LU E D PA TR O N A G E IN T H E P A S T Y EA R . M A Y W E H A V E T H E P L E A S U R E O F SER V IN G YO U A G A IN IN 1954. •« Rowan Printing Company S A LIS B U R Y , N. C. * SW Vsyt, Birth of the Savior Was Greatest Event In World's History Pleasant as it is to dream of ft. “ White Christmas" with its carols and gifts, feasting and. merry­ making, the sparkling eyes of chil­ dren delighting in Santa Claus and the wonderful Christmas trees, those things never can symbolize the tremendous significance of the day. The birth of the Saviour was the greatest event in the history of the world. In spite of all the back- slidings, Christian peoples have pressed forward steadily. However vicious and corrupt, the world today is far better than the world of pagan times; fa­ miliarity with the cross and cruci­ fixion has abolished legal tortures and much cruelty—and, If given a chance, 'might shame us into ban­ ishing the curse of International viciousness for the sake of Him who heoame the Saviour of Maa- kiod. Puritans Outlawed Yule as Frivolous The ?uritaa gevernmoat H E»ff- land outlawed Christmas in 1643. With the restoration of the Stuarta Christmas eustems and traditions were revived, but Christmas merer rogalaod its former prootigo hi Snglend. It la observed letisleuety ia the ohurehee and as a day for family roualene aad aoeial gathering*. In oeatraot to the Uriah fseating and boisterous naerry-makiag el eldoa timo, Merry-making aad gift-giving come ia for their share, however, on December M whleh la Boxing Day. The origin of Boxing Day antedates Christmas and eaa be traced to the custom of gift-giving duriag the Remaa festival of Satur­ nalia. In Christlaa liturgy Daeember M is observed as tha feast of St. Stephea. tha first Christian martyr, and during the «oi\turies when journeymen and apprentices were in the habit of levying upon their masters' customers, "Christmas Boxes” were solleotod eo St. Stephan’s day. ............ Our pleasant associations inspire sincere appreciation. May your Holiday Happiness and Good Cheer continue with you i throughout the coming twelve months* Central Telephone Company • Holiday Greetings • To our customers—our old friends of years standing-and—to our new custom­ ers, who in the course of coming years we hope will become old customers and old friends . . . to all whose friendship and good will have helped to keep the wheels turning and to make our Christmas more thoroughly enjoyable, we say thank you —thank your sincerely and heartily. We wish you a real Merry Christmas and a bright, happy and prosperous new Year. Bowles & York Service Station M O C K S V ILLE , N. C. WitlMVWCICKtMXtCIStpCtClffetCWWCtWCCWVCWWCICXICICtOCtgtOMIMWPOWMinnnifMtMIOmMM In tha glistening lights and merry manner •I tho, Christmas Season, may you find complete happiness and joyous festivity* And in the calmness #f Christmas Day it is »ur sincere hope that you' will find d*ep and abiding faith to carry you through the years ahead. . Monleigh Garment Co M O C K S V ILLE , N. C. PAGE EIGHT THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 24, 1953: K aaaaaaaa a a aa a a a a a aa a a a a a aa a a a a a aa a ta aa a a a a a aa a a a a a Ia iv ia ^ We've been .looking for you! W e have a hearty welcome because we know you won't forget these fine friends of ours. They're mighty deserving, these friends, and we'll appreciate all you can do for them. Our friends in this community, Santa, are the finest on earth. They're loyal and depend­ able. Please be as good to them as they hav« been to us. G R IF F IN S E R V IC E STA TIO N !SlgKHt«*»CT«»tWWg*lg»61gtg1g|t|g‘gtC1g|e1g1g1g|<|g|*tg*tel*lltl*l^g(gg*tglg,glglg * ** Vs * 3 » IM If» Vy y m t U3ISMJES. Vy y y y y g it » vV g y y y y g y y y y y y y y y y y y y y y y a w jja a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a ij By Papinta Knowles A NN didn’t lift her head when Jerry laid the work on her desk. "I’m sorry to rush you, Ann,” he said, "but this should be ‘fin­ ished by three this afternoon. Bancs will drop by for it.” His voice was gentle; it Implied sincerity of his regret in putting the rush work before her. There was no doubt of it, Ann thought. “Shall we go now, Jerry?" Beth Jenkins spoke at her shoulder. "If you wish,” Jerry said. I Ann kept her eyes on her work. She heard them close the office door. • They were going across the street !to Tony’s for a smoke and coffee. '. With the sound of their steps fading into silence, Ann stopped working and looked Idly at her hands. From somewhere along the street below Silent Night came softly from a radio, and she heard a vender chant, "Holly . . . mistle­ toe . . . cheap. Just two days till Christmas . . . " Snow fell softly past the office windows, making a little mound on the sills. She had wanted a white Christmas. And until last week, she thought, I had planned on having a happy Christmas.' With Mom, her kid brothers Joe and Bill, Aunt Sissy and Uncle Recms, Christmas had always seemed complete before. Aunt Sissy and Uncle Reems lived with them, and they were together on Christmas. And somehow there had never been anyone outside the little circle that Ann cared to share Firestone Home and Auto Supply G. H. C. SH U TT, Owner M O C K S V ILLE , N. C. “ I'm sorry to rush you, Ann," be said, "but (his should be fin­ ished by three this aftcrnunn.” their fun with. Not anyone she was interested in. But now— There was no use denying her thoughts about Jerry Laws He disturbed^ her the moment he stepped; (V)to the office lasl week as new manager of Rankin Real .Estate and Loans. And in spite of her effort to push him out of her m ind he had occupied her thoughts since. With Beth Jenkins working there too, she knew It was folly to think of him Beth had a way \with men. Beth was working only until she could find someone who would give her a ring and a home. She used her salary to buy expensive clothes to set off her blond attrac-i liveness. While I, Ann thought,! | fill a man's place at home. It; took money for Mom, Joe and Bill. Any money left over from her sal­ ary had to. be saved for a rainy day. and when she bought some- i thing new to wear it had. to be conservative.^ I can’t compete, simply* can’t, Ann thought. Why, then, do I keep thinking of him? She heard the vender’s chant on the street again and she thought, he’ll buy her something for Christmas. This is only the beginning—for Beth. She check.ed her thoughts with the sound of their returning steps on the stairs and turned to her. work, grateful that she had so much to do. She wouldn’t have' time to think. ( Shortly before three o’c|ock she, walked into Jerry’s office with the finished work. She smiled and laid the work on his desk. “ I hope I’ve made no errors, Jerry;” she said. "You haven’t. Thanks, Ann,” he said. She turned from his desk. "Ann—” Ann turned back reluctantly. “Yes?” If he was going to praise her for her efficiency, she didn’t want to hear itl It had been all right from others before Jerry, but from Jerry— “ Ann—” he repeated, "you know, I suppose, that this should have been Beth’s work." ! "No, I didn’t know," Ann said, ' and a little wave of anger went • over her. Tears stung her eyes. She was hurt. ; • He had made her a goat for Beth! Jerry smiled. '1 discovered soon after I came," he said, “that, you'd be the one I’d have to de­ pend on for important work. And I discovered, too, something else. ! Someday I’ll tell you. , Ann, there’s a grand Christmas show this eve-, ning at the Alden. May I take| you?’.’ For a second Ann didn’t answer.! When finally she said, "I'd love: to go," she could have sworn the ! vender’s chant coming from the street was not "Holly . . . mistle-: toe . . cheap . . .” —it was, “Happy Christmas . ; happy Christmas!" • T b i l A t this tim e o f th e y ea r it is a p p rop ria te to ta k e tim e ou t to ex p ress to y o u th e a p ­ p recia tion o f ou r en tire or­ gan ization fo r y o u r loya lty an d g o o d w ill. Msrrv Christmas Gray Smith Studio —m o c k s v i l l e , n . c . ew««tsi«i«i6iei«t<:i6isis<«isis!e<«istsietsi«i«tgt6teieie<gt6igtsi€!ststsie!s<sieis<6<2<a<e'eia gaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaasiaaaaaaaaaaasiaa «« a sI 1 {jj §S % I HERE'S TO YOUR We greet you t’.ss Clii'istmos with e profound feeling of sin­ cerity and wish you a Season of great happirc MOCKSVILLE, N. C. er Cash Grocery THURSDAY, DECEMBER 24, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE h»»»a»aasisisiasia3ia3i»aa3i2!asi5is>3l» » !rtsiaa3,3,s,as,ai,s,s,s,i,,a,as,a,2 I f.i « S £ fi i 1Ii §ii Hendricks Brothers U S ED C A R S MM<MIIgC»eggigggCtg‘C«1gtPC1Cgi«1gtgigtg|g|g1g*1ffglgi*ieielglg‘g‘e‘algletslglg‘gl* »IMl»*»ai»a»iSai»»:»l&SSl»Sl»iSiaa»i3l»)»l»ia« 5-.Siaa3iSj^a3lSs3l9ia3l>l»l*!9t»sVV % %V S?yy-S?aV Wallace 5 & 10c Store f Mocksville, N. C. § woei«tei«tc>ctc>ct«>cic>e'cic>c'<is><<G<e'c>s’C'c‘c|<ie>ste|e'<tct<'e|c w (<<c‘e‘( %% §Is1II « S-fa Good Clheer? i Twin Brook Farm Mocksville, N. C.ynitbetatitc^eta’-giststsisigieisiststcigisij'^isisig^is^'c^wstsw^’-aniis'ste^'a'eisieia k»3t3l9t9iSlS;3l3l3<3>Bl3l3i3l3l3l»Si3l3i3tS!3l»lSl3t%3l3l3l3'.3i3l3i3lSlSl3iSi3<Siai»i3l3l3^- tatr Mocksville Grill Mocksville, N. C. t i M w m w w t w i M w w w w M 'w w M W w w w M i Here's a new home decorating idea to make the Christmas season more festive. You can create Win­ ter wonderland effects with Aero Snow, a spray of realistic "flakes" for the Christmas tree, wreaths, window panes, gilt packages and mirrors. The "snc— comes in dif­ ferent colors, too, and is easy to remove after the holidavs. IT PAYS TO ADVERTISE FAR-OFF LANDS COME TO LIFE IN YULE TOYS Geography conies down the chimney on Christmas Eve. In the flood of toys soon , to spill out into the nation’s living rooms will be tho touch of many different lands. Besides a teddy bear, replica of Australia’s mar­ supial furred goalas perhaps will stand a carved wooden farm scene from German Bavaria, a South American gaucho doll, or a miniature pagoda made in Japan. Similiarly, the United States, now the world’s leading toy mak­ er, sends abroad its wild west cos­ tumes, its shinny playtime trucks and cars and earth-moving equip­ ment, its small scale railroads and sky scrapers to delight chil­ dren all over the globe, i Toy industries in Germany and Japan are on the upswing again. Germany was among the first nations in the world to make tin horses on wheels, engines that ran, animals that walked, birds that sang. Now U. S. buyers go back to cities such as Nurnberg for the output of ingenious middle-aged inventors. New toys that startle tho world often come from Europe. One such is a German duck, which, when set on an incline, proudly walks down the slope. Another is a recent gadget from Den­ mark called a “tippe top,” a wob­ bly sphere about the size of a small apple that sudenly flips upside down and continues spinn­ ing on its slem. Winston Churchill was intrig­ ued by the top when he first saw it.« In Stockholm, the King of Sweden, a cabinet minister and at atom physicist, a Nobel Prize winner,, got down on their knees at a banquet to study the myster­ ious ilip-flop action. As a mirror of mankind’s cul­ ture, toys reflect the progress of civilization. Yet an amazing sim- God Bless Christmas “There are many things from which I might have derived good, by which I have not profited, I dare say,” returned the nephew. “‘Christmas among the rest. But I am sure I have always thought of Christinas time w h e n it has come around, as a good lime; a kind, forgiving, charitable, pleasant time; and, therefore, uncle, tfiough it had never put a scrap of gold or silver , in my pocket, I say, "God Bless It”— Charles Dickens, “A Christmas Carol.’* • ' THIS IS CHRISTMAS Christmas is light. A light that vanquishes darknes; the light pf charity. iliarity can sometimes be seen between the toys of long-forgot­ ten eras and the playthings of today. 1 XMAS SPICE FOR THAT EXTRA Christmas gilt . Z. the gay touch of Yule-tide . . spice frosted with ice . . . Elizabeth Arden's great classic fragrance. Blue Grass Flower Mist, comes fo you concealed in a frosty snow­ man, masquerading as St. Nick himself . . . or in a flirtatious snow maiden, with -akish bonnet and glittering eye . . . ready to carry- your special Christmas greetings, at a most reasonable price. IT PAYS TO ADVERTISE There has never been a year when those words: “MERRY CHRIST­ MAS” had more significance than they do now. -Even though Santa is pulling onto a roof-top with a sleigh full of toys while some little rascals watch through the window, even he must be aware that there aren’t many lands where this year there will be celebrated a truly “MERRY CHRIST­ MAS.” • > • Among the more tangible gifts he will be hurtling down, chimneys, scattering at firesides and hanging on Christmas trees—there is that very intangible but precious gift which was long ago given to .American chil­ dren. It’s the heritage of democracy; the unfettered freedom of living in a land of tolerance; the valuable privilege of living in one land which peo­ ple of all lands are happiest to call their home. D a v i e E l e c t r i c M e m b e r s h i p C o r p . PAGE TWO THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 24, 1953 Ss:5iai3i2)Sii9lSl3l3l3l3lSt3l3)9l3l3lSl9)I>i3l9>3lSi3l3lSlSlSl%9l9lSlSl3t9)aiSlSl9l9lSt9)9iSlSlSiai yW SIw H W & w a if SCPyw5? 0/ w W if w w Vs? » M 57 y if CHRISTITlflS 6 REETM'G5 u » MSJ ■ Sf a s? w y » M S? » y n s?; w H ' M iy8!ygisnitgtgieteigigtgigtgigigigtgtgigigictstgieigietgietgigigigtgietstgigtsigtgtgigtgigigigigtgign sjaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaa! arie’s Beauty Shop Mocksville, N. C. Christmas Candles Are Traditional For Many Peoples "To learn your luck for the year they say,Burn a baybcrry dip on Christmas day.If the flame burns bright and the light shines clcar,Good luck will be yours through the year," This old verso is believed In many lands around the world and is said to be one of the reasons that candles in homos are tradi­ tional around tho world. The custom Is believed to have started in Ireland. As the Irish put it: “Who knows, on some Christmas Eve, Jesus and Mary and Joseph may come again, not to Palestine, blit to the Holy Isle on the farthorost edge of Europe.” And it is tho custom that the can­ dle can only be snuffed by one named Mary. Their first use for Christmas is not recorded in the annals of any nation, but that the "Christ Child Candle,” burned in the window on Christmas Eve is, according to an old legend, placed there to light His way if He makes an earthly visitation and in atonement for tho night of His birth when there was no room for Him. Miriam Alvarex and Sally Locscli, employees of the New York Telephone Company, are surrounded by the dolls the workers dis­ tributed last year to 95 of New York’s clmritablc institutions. It was one of the largest collections in the annual affair's 35 year history. NO EFFECT | H /tK E ij PRODUCERS Dyeing machines made ol' chro-' Nickel has been produced in mium-nickel stainless steel alloys many countries in the ast. In re- have made possible the delicate i cent years it has been mined in shades of colors in clothing so! quantity in Canada, Celebes, Cu- popular today. These alloys do ba, New Coledonia, Norway and If you ^should extend the time, not affect the color of the dye Russie and in smaller amounts in don’t leave the lights on the tree G u a r d A g a in s t F ire T h is Y u le S e a s o n Guard against firo in your homo this Yule sunson. The average Christmas tree can go up in smoke in only a minute or so and that doesn’t leave much time lo call for help. A live tree with roots packed in a bucket of earth is tho safest. Be sure and keop tho dirt moistened. A small tree is safer than a largo one and festive trimmings can make up what, is lacking in size. Don’t use lighted candles. (This may seem an unnecessary precau­ tion in this day of electric lights, but lighted candles contribute to tragic fires every year.) . Check tho wiring for tho tree to see that it’s not frayed and is in porfect condition. The switch for turning oif and on electric lights should be at; some distance from the tree. ' Don’t plug or unplug lights bonoath the tree. Don’t leave tree lights on when it isn!t necessary and especially when tho ' family is away from home. From time to time, chock over the tree and see if needles near the lights are tufning brown. If they have, move the lights. Watch the calendar. New Year’s is the day for the tree to go down. for more than a half hour at Place tho tree weU away from, stoves, radiators, and other sources . of hent. When you smoko, stay- away from tho tree. Also be sure' that the treo is secured In such a. way that II cannot fall. Do not put It near a doorway where it might • block an avenue of escape, should", a fire occur. Make Gifts Attractive Make your Christmas package- .attractive because half of the pleasure of the gift is the wrap­ ping and opening a beautiful pack­ age. Uso plenty of ribbon and gay ■ colored paper. Add bells and' Christmas ornaments to the bows. Tie ribbon about the corners and1 put the bows off-center to make tho packages distinctive. A lit­ tle disguising by putting small boxes in larger ones before wrap­ ping adds lo tho mystery of the gift. STEELS Pressure vessels for chemical processes operated at tempera­ ture-, as low as 150 degrees be-- low zero Fahrenheit are made" of nickel alloy steel: since ,ordinary steei becomes 'brittle- at such: low temperatures. Othe special nickel- containing materials permit the- use of such vessels at tempera­ tures below minus 300 degrees- Fahrenheit. ' . 1 j A p l e d g e o f f r i e n d s h i p , g o o d w i l l , \ a n d a g e n u i n e d e s i r e t o s e r v e . w _\ Norman Ingle Jewelers | Salisbury, N. C. | THURSDAY, DECEMBER 24, 1953 THE MOCKSVILLE (N. C.) ENTERPRISE PAGE THREE M E R R Y C H R I S T M A S T O O U R M A N Y F R I E N D S tocksville J tf Flour Mills, Inc. ' 1 y . SfMocksville, N. C. .• y . B. . . . . ■ ■...» ■ ' • . ■ : y B>Si3l9g9lSl3i3l3;3t3i9t%S)3)9lSlSl9i3)Sl2]9SS!S:3i3tSl3lSl3)a3l%3l3t»l3l3l»S)3l3l3l9i9)3l3t|jI ' ■ v v I I « j|; : ' ■ • . I aSfy y v ySf' V v " " ■ • ' W I1A £ f*i« « I« >5 1 21i *5 9sJS s§$1 I % 1 Davie.. Florist Mocksville, N. C, Double v ’Santa Clau£ * By Royce Fields A S WAS his custom during Christmas week of each year, George Brandon leaned against a pillar in tho toy department of the big store, and watched the kiddies. Whenever, with a particularly hungry look, a child picked up a toy or eyed one longingly, George raised his hand. This was a signal to the clerk- that the price of the toy was on him. George >was no millionaire. It was just that, not having folks of his own to buy Christmas presents for, he spSnt his gift money on the kids. It gave him a satisfac­ tion to see their faces light up. A girl had entered the store and was standing by a pillar near tho one George was propped against. He had noticed her, with more than casual interest, when she came in. She had a complexion that was the clearest he had ever Sitter’sj "I'll second the boy’s ques-' tion,” George said. “ Just what is going on here?” seen and, although he couldn't see them at that distance, he would have bet she had blue eyes. Her hair was shining blonde. When George turned his atten­ tion back to the toy counter, a little girl, wearing neat but worn clothing, was eyeing a doll almost as large as herself. He raised his hand. With a slightly bewildered expression, the clerk picked up two dolls, wrapped them, and handed them to the child. The actions of the clerk puzzled George. He was certain he had only signaled once. George turned his head to look al the blonde girl again. The girl caught him staring at her; and she smiled. A 'very nice smile George would have lilted to have a smile like that, just for- himself, every.day With an effort he brought his gaze back to the toy counter A small boj was wistfully look- ir g at a train George' could pic­ ture the kid at home, on the floor, playing with it. It would be nice to help a boy like that assemble the toy He raised nis hand This time the clerk seemed more puzzled than ever. He started to reach for the train, then instead, he motioned for George to come lo the counter, George had been about to go over, anyway, to see "rhat was behind the man’s strange actions. ^ "Do you know that blonde girl standing over there by the pillar?" the clerk asked him. / ‘No,” George told him, "but I|d sure like to. Why?” “ Did you notice 1 gave the little girl two dolls, when you sig­ naled?” . "Why yes,” George answered him, "and I wondered about it. However, I figured you knew the rhild and she probably had a sis­ ter that you thought should have a doll too.” "No, that wasn’t the reason.” The toy salesman motioned to the blonde girl. She had been watch­ ing them with interest and at the clerk's wave, she came over. "Miss Marvin,” the man behind the counter introduced them, “ this is George Brandon. George, this is Joan Marvin. I ;hink all nice i people, such as you two. should know each other! ” The girl extended her hand eagerly and George took it Just as qukkly. He saw that he would have won his bet—her eyes were the bluest of the blue I “Say, what’s going on here?” The small boy had turned away from the glistening train and was looking at the trio wonderingly “ I'll second the boy's question,” George said. "Just what is going on here?" The salesman laughed. "The rea­ son I thought you two ought to get together, is that you’re giving me signals on the same kids," "You see," he told George, "Miss Marvin made the same ar­ rangement this year, in regards to giving the kids toys, that you've .'been making for years!" One Christmas, a few years later, Joan Brandon said to her hush-nd, "Remember the Christ­ mas we met, George?" "Of course," he answered, "I'll never forget it. Why?" "Well," she laughed, "I'd seen you in the store the previous Christmas and it took me a year to figure out that scheme to meet you. One little girl got a double Christmas out of it, anyway!" V.!ltSLii By SHIRLEY SAROENT O N ACCOUNT of being the old­ est in a big family, I’ve been baby sitting longer than I rcrnuiu ber. Since I was twelve—that'd be four years now that I’m with­ in hinting distance of my sixteenth birthday—I’ve been sitting for other people for pay. I've always welcomed jobs but tonight what I'd welcome is a date—so -wliat happens? Four times I'm called to our wall phone and four times I have to turn people down 'cause I already promised the Laytons The Laytons are klnda old to have Jennie, four, and Jimmy, six, but they planned it so their first two would be grown-up be­ fore they had any more. Anyway, nobobdy calls me for a date, not that anyone does very often, so I'm oiT for an evening of fun and hilarity. Baby sitting, hawl They aren’t babies, and try and sit with those two. For ex­ ample, Jennie gnaws a fruitcake while I'm helping Jimmy with his train, they have two fights, Jimmy turns on all the lights as fast as I turn them off and finally Jennie knocks the Christmas tree over. It was a big tree with a standard and all. but she catches it with her jump rope. Quick-like I run in and pull out the plug, thanking my stars that no fire started,' then herd them up to be‘d. Three stories later they’re both asleep and I hurry down to wash the dishes. , Tired now, I’m thinking of the good time my friends are having and wondering again why I don't have more dates. The hall mirror shows the same old reflection. “ Oh, please,” his face is all eager, “ stay. I hate to be alone.” Short brown hair, brown eyes and a big mouth that hides my crooked teeth, if I don’t forget and grin. (Continued on Page 4) PLATED WARE Silver-plated ware is normally stamped fro mnickel silver, an al­ loy of nickel, copper and zinc, and then electroplated with silver, i r a t f o r d JEWELERS, PAGE FOUR THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 24, 1953 Bia%»2t%»%S!3!3!3:Si3i3i3>%3;3i3)>:ai3iSi2!3!Si3)»!3!>!a>3!»!»i3l9!SiSlSlS!3)3i9i3!9i9!9;3! Please accept o u r deepest appreciation of ycuf business and let us wish you Merry Christmas. Christinas ‘Open House’1M0RE ABOUT Was Early Saxon Custom SITTER s EVE 1 Soon's I have a little more mn*mv ( y* ^ t .. » ^@1 y Star Laundry a S A LIS B U R Y , N. C. At Christmastide, the great hall of the Saxon Lord was thrown open to peasant and noble alike —all mingling democratically and exchanging gifts and hearty cheer during a great feast and festiv­ ities composed of dance and song. With a tremendous burst of shout­ ing, the Yule log was dragged into the hall and placed upon the open; t •fire pit. These democratic Christ-1 mas festivities lasted until the1 last dying embers of the log. j , In our south, prior to the Civil 1 can a fiord braces Jennie yells and I wnui- n- fi'om a nightmare By the H'u I’m back downstairs. It’? m.'ni!> t»n o’clock and I’ve stlli got t.hv darned tree to set up I.lltp I su> It's a beautiful big tree cpiUin high, loaded with decora tlmiF There I am half under the tin trying to hold It straight and kuus the globes on at the* same tlmr when I hear the front duoi opei. Somebody yells, "Anybrdy hornf’ - I'm so startled I let the troi sway, so this voire yells. •Tim berl” and a long arm grabs fru the trunk - : Looking up between thr branches, I see a tall, dark-halrerl War, the slaves, following this, boy’ neither handsome nor home Saxon custom, would soak a log' ,y • '‘Than^ " Vm 8 111116 breath in the cypress.swamps,to extend the length of their Christmas freedom. tvctgtc!e%>eie!«te'ets>e<€>s‘s'gteigt£i3!gtgtg!gt'tgtc'stgt«tgte!ct£tei«tgtet£!etetc>etetc>c<€te B)»)3;>lSiSS3g3)Si3l3lSi3)%3)3i3iai»l3i9i3l3l3l9iSl»l9)3iS)a)9l»1>tS)S)»»i3)3)3i3)2iStS)»lSi3iS) % ................................... Thanks. less. "I'm Oliver Layton," he ex plains, “Isn’t that a heck of a name?''. Pine needles are thick In the This unrestrained . friendship I air. “ Not so awful," I laugh back. p lea sa n t a ll th ro u g h th e H o lid a y s. United Variety Store May the true meaning of Christmas be yours. West End Grocery Mocksville, N, C. [,«tGt$(a«igtg%!gts<3'ete:st£<$'e>s‘e<e<s!<i'C'e<s«z'£!£ts%<s<e!ve<c<6‘e>c<c<s<ets'ctg%tg%<ei4 between the' Saxon lord and his serf at Christmas time has come down to ,us in the form of the hospitable '<Open House.” “Merry Christmas” In Other Languages Merry Christ mas I^Merry Christ­ mas! The spirit conveyed by these words is the same in all countries but the words themselves some­ times fall harshly on American ears. "Merry Christmas’’ in French has a soft and musical sound. It is “Joyeux Noel.” In Spain the greeting is “Fe- liz Pascus," and in Italy, “Buon Natale.” For Sweden it is “God Jul” and Norway, "Gradig Jul.” In Germany and Holland that greeting is a tongue twister that will stump the average Ameri­ can... The Germans say “Froeh- liche Wiehnachten” and the Dutch “Pleizierig Kersfeest.’ ’ I’m Margie, the sitter Your folks are out." “I know. Look here, can't we do something about this tree?" A few minutes later we collapse into chairs, staring at the still- lovely tree. “Thanks so much Con I get you something to eat or any­ thing?” “Say, that’d be keen Would you?" Well, of course, 1 do and, while I Oliver eats, he tells me how he’s staying at a friend's this vacation but decided to come home and take his girl to a dance. "So I called her and came clear in by blis. but she didn't wait. She went with somebody else. Heck," he grins, “now I'm sorta glad she stood me up.” "I’d better be on my way now that you're here to baby sit," I say reluctantly. “ Oh, please," bis face Is ali eager, "stay. I hate to be all alone." Back In the living room then, he asks me all about the kids and about me until, to hear us talk, you'd think we were old friends. ( like the way he talks, slow and quiet, and the way his grin lights up his whole face. Me tells me about boarding school and his friends and what he wants to do. Suddenly, he Jumps up. “Let’s dance. We can roll up the rug . . R turns out we’re both such sad dancers we have to take our shoesBut whatever the language the spirit behind this greeting is the i off so’s not tp hurt each other, same wherever there are men of good will. T H E M Y S T E R Y O F GO D’S FIR M A M EN T The “Star’ which signaled “the First Christmas” may be inter­ preted in many ways. In all such interpretations we must put our­ selves as nearly as possible into the, social and psychological frame of mind of those whom we try to understand. The astronomer knows that through the ages the Word “star” has been used to in­ dicate almost any celestial phe­ nomenon. We still speak of “fall­ ing stars” or ‘‘shooting stars" which we know quite well are not stars at all. In more ancient times the comet was called “hairy star” and was derived from the Latin word-"coma” meaning hair. The planets were the “wan­ dering stars’’ as opposed to the “fixing stars” and from the Greek word for wanderer we derive our word “planets.” The Star of Bethlehem could have been any of these. It could even have been a “new star” or nova which suddenly burst forth with a many-thousand fold in­ crease in brilliance, due to some great stellar catastrophe. These are all explanations of what the !‘star” could have been. Had it been any of the above, it would have been seen by many people, and in literature would have been found many references to the appearance of the .object which attracted atention. But nowhere in the literature or in the folk­ lore of any of the peoples noted as astute observers' o cfelestial phenomena do there references, exist. , From this we are forced to] conclude the appearance of the ^ star was a sign given only to ; the Wise Men to see, I THE PROPHESY Isaiah 9:Q For unto you is a child born, unto us a son is given; and the gov­ ernment shall be upon his shoul­ der; and his name shall be called Wonderful Counsellor, the mighty God the everlasting Father, the Prince of Peace, IT PAYS TO A P V E im SE But we laugh a lot and the radio sounds fine and I fit right Into Oliver’s arms. At midnight, he kisses me lightly on the cheek. Well, it’s the happiest sitter's eve I've ever spent and, from the look in his eyes, I can tell,- it’s going to be a Happy Holiday. [nother Christmas finds us joining hands with neighbors to wish you well. S A LIS B U R Y , N. C. Veterans Grease & Tallow Co. PH O N E 3411 H ARM ON Y, N. C. THURSDAY, DECEMBER 24, 1953 1 THE MOCKSVILLE (N. C.) ENTERPRISE PAGE FIVE MflW lKM jf irx W. N. Smith Esso Seifice | {Sv<ci(ic>c>e>c<cte|c<c,ctcte!(>e<e>e>c>ete>e|eie>(ieie>e>e<s|8>c|ets|stc«%^(ieie%>sietc V S TVS I\ Oak Grove Servici Station ; I Route 2 MocksvilleJ C. -R av Christmas Trees Can Be Put to Many Uses After New Year’s . There are a number of things you can do with your Christmas tree after New Year’s besides burning it., ' If it is a fir, for instance, it can be anchored in the back yard— perhaps in a corner of the gar­ den—and used as a bird feeder the remainder of the winter. Pieces of suet and little feed bags may be tied to the branches. A container of water should be plac­ ed beneath the tree and kept fill­ ed so the birds will have a drink every day. Or, cut off the branches and place them, curved ends up, over flower beds when the ground is exposed. An evergreen mulch helps prevent the soil from heav- ihg during alternate freezes and thaws. Long branches may be built into little lean-tos to protect tender shrubs from sun scald. The needles of a Christmas tree can be sprinkled beneath acid- loving plants such as laurel, an- dromeds, rhododendron and blue­ berries. If the needles on the tree a ^ still firm, use the branches in an outdoor windowbox. Moisten the bottom and tamp the soil firm around them. This will generally give you greenery all winter. If you must burn your Christ­ mas tree, don’t toss it onto a fire­ place.' Cut off the branches and burn them safely, one by ^one. And remember, a Christmas tree tossed into the street can become a fire hazard if playful children pick it up and make a bonfire of it in a vacant lot. Quick as St. NickA In IT WoltJ’T BE LONG before Santa corae9 to town and Christmas Wishes all come true! This Ss the day the Santa Claus set wakes early and rushes to iind what's under the tree. No time at all ior drc. on this merry morning. Thai a why these fireman's red cotton flannel pajamas are Just right ..for this young chief. He's handsome and warm in them awake or asleep. And best of all— they're equipped with Dot Snap­ pers, ' the efficient, convenient fasteners that are easy ior on nxcited little boy to manage. I I 1 T o E v e r y M e m b e r o f Y o u r F a m i l y \ . . M e r r y C h r i s t m a s ft s?r hrf Quaint Rehearsal Of Christ’s Birth Found in Old Carol ‘<Auld Lang Syne” has become such an integral part of our mod­ ern New Year’s eve that no cele­ bration, however, gay .would be complete without it. The-music sheets for those nos­ talgic strains simply say “Robert Burns—Scotch Air.” and Robert Burns generally is supposed to have written it after he had settl­ ed down on, a farm and taken himself a wife following the sweeping success in 1778 of the( second^ edition of his “Poems.” Well and good, but Auld Lang Syne was not exclusively a Burns product, nor did he claim it to be. In a letter to George Thom­ son, a publisher, Burns explain­ ed: “It is an old song of olden times, which has never been in print. I took it down from an old man’s singing.’’ Modern Scholarship has discov­ ered that Burns was wrong when he told Thomson Auld Lang Syne never had been in print. Its re­ frain, at least, was printed ob­ scurely long before Burns heard his “old man singing.” Further, the orginal song often has been credited to Sir Robert Aytoun (1570-1G38) Aytoun was one of the earliest Scots to use the lowland dialect as a literary medium. Multitudes of Ameri­ cans descended from non-British stock are perpetually mystified by this dialect, nor does it seem to make much sense in the stand­ ard translation. Regardless of its origndl author and origin, it was Burns who gave “Auld Lang Syne” its immortal­ ity. And though the. bells now welcome the New Year with poy- our peals, symbolizing mankind’s hope for a bright future, the nos- talgiast of “Auld Lang Syne” summariizes an adherent reluc­ tance to leave the security upon a future which, however promis­ ing, may not be more pleasant. Thus, it remains a part of the English speaking heritage to ‘‘Drink a cup of kindness- yet For Auld Lang Syne.” /9SS 'f * v •*Y W e t a k e " t i m e o u t " fr o m a b u s y s e a s o n t o e x t e n d o u r v e r y b e s t t o y o u . r. >' Pet Dairy Products 1 .r ■ S A LIS B U R Y , N. C. it s - s s *i n §1 W i Weil Equipped a ai H I Mocksville Ice & Fuel Cos Mocksville, N. C. leiststeietstsiets me te«tgtetgisie!6tei« !€ « « « « < < ; HAVE PEN, WILL SIGNi Hollywood actress Sue England proves that she is brainy as well as beautiful by innovating a new practice in movietown. She • alces her new Paper-Mate desk set with her on all interviews with producers. If she lands the role, she's well equipped—in more ways than one —to sign the film contract, T h i s is a t i m e f o r r e m e m b e r i n g o l d f r i e n d s , ' * a n d w e n u m b e r y o u a m o n g o u r s . Irvin W ILK ESB O R O S T R E E T C om pany. M O C K S V ILLE , N.C. PAGE SIX THE MOCKSVILLE (N. C.) ENTERPRISE THURSDAY, DECEMBER 24, 1953 V : I ■ .j? H S?a' » ... S? » ‘ » M ’ IPtgasigiststsigtgtg-gtgtgtgigigtgtgtetgtg'.gisietg'-s’etgigie’gie'steie’etgtg^'gigtetstgtg^igtgisig :*ies Salisbury, N. C. aaaaaaasiaaaaaaasiaaaaaa& asaa& aaaaaaasiaasjasiaaa.aaiaaas'' • I • f? MIRRV CHRISTMAS MERRY CHRISTMAS FRIENDS/ WE GREET YOU! We 're thinking about you and Wishing for you immeasurable happi­ ness in the Yuletide season. We've en­ joyed our associations with you these past twelve months and eagerly await the opportunity of serving you in the future. JCNRMTMMi ;MIRIIV CHRISTMAS M«RR* CHRISTMAS. MtRRY CHRISTMAS, ft » 0 M M H 1? I 0 i^icxKtetcteicwieteieteieietetsiKietetetsicteietetcisietEieteieieweieteieieieteieieietKieicig fc’^3#3^aaaa»a»aaaaaa»aaaaaaSi&&2lSiSl2>Si2ia2iaaa-.a;S;2iaa3;&2!5;>j A. E. Hendrix Insurance Knox Building gt Intersection Lexington Road & Depot Street Phone 328-W Mocksville, N. C. sn ji & A dds Much t o th k o v o f C hristm as to end O ur V ery B est W ishes to T hose W hom W e Serve Paul Bowles Service Station Route 2 . ; Mocksville, N. C. $ >lisieis!e>sigigist£!S!sts!s«!ets:E!e!e:e!S!ete<2!s!e,.e!e!stsKt*e!eietgtststE!a!cete:e!ststs!g‘S aaaaaaaaasiaaaaaa a a aa sa a a a aa a a a a a aa a a a a a aa a a sia a aa si! By Lllllncc M. Mitchell q'VERYONE in the ctUltS thought l*—1 It an excellent and Unique idea: 'double Christmas! Wonderful! Two connecting rooms which would ac­ commodate any nuniber of mem­ bers and guests—one room a real­ ly, modern ; Christmas tree, the other an old-fashioned tree. ■ "All .right, then," laughed the president when 'the clamor had died down. "It's voted, definitely. Now, for the two committees to handle the two trees. I’d like vol­ unteers. I know how busy every­ one is at this time of year and if 1 may have volunteers, I shan't be imposing on anyone." Unfortunately, all those who vol­ unteered wanted to trim the mod­ ern tree. No one offered to take the old fashioned tree In the old- fashioned7 room. Linda Marbry was almost as astonished as any­ one when she said she would be responsible for it. Outside in the clear, cool night she wondered why she had offered. She was a-stranger in this com­ munity and knew„no young men who would put up the thirty-foot tree for her. A teacher of fresh; man English in a small hlgli school does not meet many young men.. At last she decided to let the putting-up of the tree wait and get the ornaments ready: mostly homemade', the Christmas com­ mittee had told her: something like pioneer life, the tree must be. So she went into a grocery store and asked for popcorn. It was the same answer in five stores: usual- "Popcorn!” his voice and blue eyes were both incredulous. "First time I ever saw a young lady running around in (he dark for popcorn!” ly they had an excess of popcorn but now they were entirely out. IT PAYS TO ADVERTISE Linda Lrm was getting panic- strJc)r<’>' !\v hnlf past eisht *hni r,-Eht. ' . At nearly nine o'clock sIa> saw a man in a > small grocery store window , leaf li utb lo pull out the' light. :Oh. wni'.i wait, plense," she itnid .breathlessly ns she pusher! open the big door, . •*V.'r>11. you : must ' be really hungry!” . laughed, the tall, dark young man toaslnsly "What'll It b e'" ^ ' 1 . "Popcojh!" she said.; “ Popcorn!" his voice and blue eyes, were both incredulous. "iTtrst time I over saw a young lady run­ ning around In the dark for pop- . corn!" ’■ ■ > So' Linda told him all about the old-fashioned tree and how. she had been unable to buy any pop­ corn which must be popped and strung and ready for the tree. "They gave you little enough time,” he grumbled as he went back to the shelf. “Whoever heard of getting up a thing like that in one day! I’d best help you. 1 .think. I'll pop tomorrow morning while you are in your school." “But your job here?" “Oh, this isn't any job. I’m a newspaper photographer.- Just came down to visit my aunt and uncle and helped out in the store while they went for a visit with a sick friend. Seems rather strange, doesn’t It? I got time otf which was unusual. Came down here although I could have gone for the holidays to,any one of a dozen places. You offered to trim a tree. I have the popcorn—” he hesitated. “ —and you offer to pop it." Linda Lou added in her breath­ less fashion. “Why—it—it’s like a istory, almost. Isn’t it?" "It' certainly is," he agreed, smoothing his black hair back as he stared down at her. "Now I never wrote a story in my life but I have noticed that in the stories, it all ends happily.” Linda felt the color rising in her cheeks. "Well, I’m sure.it will make a very happy ending if that tree is up and trimmed In time for the party, {he Christmas party—” "Ah, now, don’t just use words to drag this out. Christmas party, indeed! Of course, they don't use Christmas, trees at any time ex­ cept Christmas. Well, I’ll get the tree up and’pop the corn and we’ll color it pink. How does that, sound?" "It sounds wonderful,” she mur-j mured. ' ' ! "Yes, the whole thing sounds wonderful to m«, too. With maybe; a bit of mistletoe on a long, highj branch." : . i Linda Lou only nodded It; seemed a part of a huge pattern,; she thought. -A pattern marked; MERRY CHRISTMAS. j IT PAYS TO ADVERTISE Sheffield arniture Company M O C K S V ILLE , N. C.R O U T E ! 08:Ajr C. J. Angell Jewelry Phone GO • On The Square ■ f Mocksville, N. C, : • WE ARE GRATEFUL TO YOU FOR YOUR CONTINUED YEARS, AND WE WISH ALL OF YOU A MERRY CHR: ATRONAQE OVER THE MAS. Sanford-Mando. • Co. ■ Sanf or Rankin - Sanford Co. C* C.■ otor Co. inford Sons Co. THURSDAY, DECEMBER 24, 1953 THE NIOf’K f v (’’UPRISE l}SlSlSia®)aa2lSlSi2l2>2l3l2l3l2lSlSl2tSl3sSiBlSiB!S!3!9l2l2!a a a Sla a *)la a a a a a a a a ?j! i 1g&#5 S i I Mocksville Cas Mocksville, N. C & i ' " i i £ i » s » » » » » » a* a a a a a a a a a a aa a a a a a a 2 ^l3l*aSl3!aaaaasiaaaat.3 i r5 And here's ours, as sincere andfes genuine as we know how to v.-r make it. « A t It is our fondest wish that every joy will beyours for thecoming ^season. A4osf B e lo v e d C a ro l I s 'S ile n t N ig h t ' The most beloved carol of the many that are sung in all parts of the world Is “Silent Night” that simple ond tender German song. Its origin was unknown for many years. Recent research, however, disclosed that It was written by Joseph Mohr, an assistant priest in Oberndorf in South Germany. The melody was composed by a schoolmaster, Franz Gruber, The poet and tho composer were part of the choir that sang the carol for the first time on Christ­ mas Eve in tho Oberndorf church in 1818. ■ : The night it was sung the small church's organ was out of order and the choir sang to the accom­ paniment of a guitar. ; . 1 Since then the carol has been sung to the tune of almost every musical instrument in the world and in the languages of nearly all men. That Reindeer Is Becoming a Tradition That reindeer is becoming an American tradition. ' Once upon a time there was a reindeer with a built-in flashlight bulb for a nose. You know, Ru­ dolph, the red-nosed reindeer. From a small beginning in 1938, the little animal with the built-in beacon has become as familiar as Humpty-Dumpty and Cinderella to youngsters everywhere. First invented as a sales give­ away promotion for Montgomery Ward by, Robert L. May; Rudolph was featured in many free booklets before he became associated with Christmas. Songw riter Johnny Marks liked the title “Rudolph, the Red Nosed Reindeer,” so he wrote a song about it. He was so sure he had a success that he start­ ed his own Publishing company, using “ Rudolph” as his first re­ lease. Gene Autry made the initial recording, and that one record sold 2,000,000 copies. Last year, there were, 16 differ­ ent recordings of the song for sale, ranging from boogie-woogie by Sugar Chile Robinson to Bing Cros­ by, and cowboy singers. PAGE SEVEN Little Indiaa Town Owesjame To UnusuaName The little coiriunity of San­ ta Claus, Iiulinii/ou'Ds its fame to its unusual tine. Ami at Christmas timejs small post- oITlcc is swaiicil with mail from llirotighotjtlic world by people who \\\l their letter postmarked Sitn Claus. In addition, dusands o t let­ ters arc rcceiS at tho post- office addres| to "Santa Claus, Santa lus, Ind.” ' The notes jiffe from the wistful to thjlosperate, re­ questing suchiings as it ma­ ma doll, a slj a sweater, or a pair of overjes. They com cfci countries all over the wo-—small village in Canada .| big- cities in Europe. | Christmaspday Is Too Cqnercial, Many Pece Believe Today we lifmany people say that Christmjhas been “ com­ mercialized” 1 has lost its true meaning. f Has it? ? Is it wrongs one time in the year to makoe dominate theme one of givlfrather than re­ ceiving? | Giving hasjays been a major part of the (stmas theme—the giving of joji happiness to oth­ ers whether be spiritual or material. J It is truclt economically no other holidor festive season contributesjmuch to, the wel­ fare of the id. The holiday has hardly pasjinto the new year before thoas are at work on toys and Ctmas specialties for the next jjf Giving \remain one of the great joytfChristmas for all time to ci|The idea has sur­ vived thrt|the centuries and nothing w.'er stop it. What, aill, brings more joy than seeijeople happy; than watching fen and loved ones open giftsexpress their thanks in words deeds?Y4- 2n U^J _i___ _ l/ ou oC o v t-W ill flamsi I jo u PAGE EIGHT THE MOCKSVIL! Sl»Xl>lS)9l>l9l3)ai9lSlSi3)3l9lSlS)9l9lSl%SiSl9l3)9l9l9lSlSl9l3l»Stmft9l9lM)Sl9lBl>lXAM 8 Mocksville Home & Auto Supply C. R. Crenshaw, Owner Mocksville, N. C. C H RISTM A S E V E M EM O RY C H EC K Did you Remember . . , . . . to take home n few extra toys? If you are expecting two or three neighborhood small fry to drop in,' you can be sure six will show up. And three toys and six children' do not enhance “Peace On Earth.” Did you Remember . . . . . . to check Uie Christmas tree lights? Not day before yesterday. Not last week We mean right now. A few.stores are still open and you can supply new ones. Better pick up a few more ornaments, too. Did you Remember . . . . . . that you told all those people to drop in for refreshments tonight? Better check on the cake, cookies, soft drinks,' and other goodies. MftMMlMAMlMlMftMtMlMlSiMiafcSlSiMlMlMlMikMlMlMqMlIlMt- S i I£ Did you Remember . . .I ’ ... those last minute Christmas cards? If not, you can send tele­ grams to friends too far away for cards to reach them by Decem­ ber 25. You can even have a mes­ senger call at your home while the guests you Invited in for snacks are there—and probably everybody will remember some­ one far away who should have a Christmas greeting. ^ E (N. C.) ENTERPRISE THURSDAY, DECEMBER 24, 1953: T ra d itio A l R u m E g g n og F o r H o lid a y P arties Did you Remember . . . . . .to hang some kind of Christmas decoration outside the house so passing strangers may enjoy some of the Christmas ........................................... A really authentic jnog has always called for rum. This happy combination has end\» since Early American times as a symbol of gracious holiday hospjy, S. S. Field, author of The American Drink Book says, “Rum is tVj eggnog what holly and plum pudding are to Christmas.” The temjj eggnog, above, is shown in a 1725 silver Monteith bowl. In thoiays bowls were “large enough for a goose to ■ swim in" and “open hrt eggnog parties from Christmas to New Year’s Day were the most i/e celebrations. Today’s hostesses can make old-time eggnogs or u|new short-cut recipe. For the traditional h%y eggnog (20 servings): 12 egg yolks, Vi lb. sugar, 1 qt. milk, 1 bci(fifth) gold Puerto Rican Rum—any brand, 1 qt. heavy cream. Beajks with rotary beater until light. Add sugar. Continue beating until rny. Stir in milk and rum. Chill 3 hrs. Pour into bowl, fold in hea'ream, stiffly whipped. Chill 1 hr. Top with nutmeg. ^ | . For a "quickie" rocipcy major dairies supply excellent mixes during the holiday season. Simjad 8 oz. Puerto Rican Rum per quart of mix, fold in 1 cup of stiffly v.*d cream. Chill 1 hr. Sprinkle with nutmeg. W e ’d like tefsit at y o u r fire s b e to greet you person ally, M erry Christhas. glow that is in your ho.|id re-1 cheer you scatter, the more you| •fleet it around your if Re- • member, everyone has jrt in this Christmas cheer,! just; jn.o j will gather.Hall Drug IT PAYS TO ADVERTISE ]\ocksville, N. C ' o1'